Transcript: Human NM_080841.2

Homo sapiens protein tyrosine phosphatase receptor type A (PTPRA), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
PTPRA (5786)
Length:
3153
CDS:
219..2600

Additional Resources:

NCBI RefSeq record:
NM_080841.2
NBCI Gene record:
PTPRA (5786)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080841.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002838 CACCTATTTAACCACTGTCAA pLKO.1 437 CDS 100% 4.950 6.930 N PTPRA n/a
2 TRCN0000350904 GAGAATGGCAGACGACAATAA pLKO_005 887 CDS 100% 13.200 10.560 N PTPRA n/a
3 TRCN0000002835 CCCAAGCACCAACAGGAAATA pLKO.1 824 CDS 100% 13.200 9.240 N PTPRA n/a
4 TRCN0000338282 CCGGCAGAAGGACTCCTATAT pLKO_005 1982 CDS 100% 13.200 9.240 N PTPRA n/a
5 TRCN0000002836 GTGTGATGTTTGGATTGATAT pLKO.1 2809 3UTR 100% 13.200 9.240 N PTPRA n/a
6 TRCN0000338280 TCAACGGCAGAACCAGTTAAA pLKO_005 330 CDS 100% 13.200 9.240 N PTPRA n/a
7 TRCN0000367404 TCATCACTCAGTTCCACTTTA pLKO_005 1387 CDS 100% 13.200 9.240 N PTPRA n/a
8 TRCN0000338333 TCTGCTAGTGATCGTGTTTAT pLKO_005 674 CDS 100% 13.200 9.240 N PTPRA n/a
9 TRCN0000367471 CACCAATTCTATAGGCATTAC pLKO_005 497 CDS 100% 10.800 7.560 N PTPRA n/a
10 TRCN0000367427 TTGGATTGATATCGTGAAATC pLKO_005 2818 3UTR 100% 10.800 7.560 N PTPRA n/a
11 TRCN0000338334 TAGGCTTCTATTACCTATTAG pLKO_005 2717 3UTR 100% 13.200 7.920 N PTPRA n/a
12 TRCN0000002839 CAAATCCAACTTCTTCACTAA pLKO.1 367 CDS 100% 4.950 2.970 N PTPRA n/a
13 TRCN0000002837 GCCAACATGAAGAAGAACCGT pLKO.1 1860 CDS 100% 0.750 0.450 N PTPRA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080841.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06816 pDONR223 100% 99.9% 100% None 882C>T n/a
2 ccsbBroad304_06816 pLX_304 0% 99.9% 100% V5 882C>T n/a
3 TRCN0000472631 CGCGTTCTGTTACATAAATGCCCC pLX_317 19.6% 99.9% 100% V5 882C>T n/a
Download CSV