Transcript: Mouse NM_133346.2

Mus musculus ankyrin repeat and SOCS box-containing 6 (Asb6), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Asb6 (72323)
Length:
2129
CDS:
115..1371

Additional Resources:

NCBI RefSeq record:
NM_133346.2
NBCI Gene record:
Asb6 (72323)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133346.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084222 ACAGTGATACCCAAGACACTT pLKO.1 1346 CDS 100% 4.950 6.930 N Asb6 n/a
2 TRCN0000154583 GATGATCAACCGCTTCTGCTT pLKO.1 807 CDS 100% 2.640 3.696 N ASB6 n/a
3 TRCN0000084219 CGTGAGCAATGCGTTGCTGAA pLKO.1 312 CDS 100% 0.405 0.567 N Asb6 n/a
4 TRCN0000304406 CAATTTCGAAGACCCTGTTAC pLKO_005 393 CDS 100% 10.800 7.560 N Asb6 n/a
5 TRCN0000084221 CCACATTGAGCTTCTGCATAA pLKO.1 1062 CDS 100% 10.800 7.560 N Asb6 n/a
6 TRCN0000316005 CCACATTGAGCTTCTGCATAA pLKO_005 1062 CDS 100% 10.800 7.560 N Asb6 n/a
7 TRCN0000374332 CAGAAGGCTCACTCTCCATTC pLKO_005 280 CDS 100% 6.000 4.200 N Asb6 n/a
8 TRCN0000374331 CACTGTATTCACCTGCATCAT pLKO_005 741 CDS 100% 4.950 3.465 N Asb6 n/a
9 TRCN0000084220 GCACATTGCTGTCCTGAGAAA pLKO.1 429 CDS 100% 4.950 3.465 N Asb6 n/a
10 TRCN0000316006 GCACATTGCTGTCCTGAGAAA pLKO_005 429 CDS 100% 4.950 3.465 N Asb6 n/a
11 TRCN0000084218 CCTGCCCTTTACTGCTATGAA pLKO.1 1476 3UTR 100% 5.625 3.375 N Asb6 n/a
12 TRCN0000315931 CCTGCCCTTTACTGCTATGAA pLKO_005 1476 3UTR 100% 5.625 3.375 N Asb6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133346.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09586 pDONR223 100% 82.5% 89.3% None (many diffs) n/a
2 ccsbBroad304_09586 pLX_304 0% 82.5% 89.3% V5 (many diffs) n/a
3 TRCN0000478926 CAGCCATCTTTGTGTGCCTTTTTT pLX_317 30.3% 82.5% 89.3% V5 (many diffs) n/a
Download CSV