Transcript: Human NM_133474.4

Homo sapiens zinc finger protein 721 (ZNF721), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZNF721 (170960)
Length:
4673
CDS:
195..2966

Additional Resources:

NCBI RefSeq record:
NM_133474.4
NBCI Gene record:
ZNF721 (170960)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133474.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107485 GCCCTGAATCAACACAAGAAA pLKO.1 1317 CDS 100% 5.625 3.938 N ZNF721 n/a
2 TRCN0000107487 GAAGATCGTGACAGAGCCTTT pLKO.1 780 CDS 100% 4.050 2.835 N ZNF721 n/a
3 TRCN0000107488 GAACGTGTGTAAAGTGCAGAA pLKO.1 362 CDS 100% 4.050 2.430 N ZNF721 n/a
4 TRCN0000243748 CTGGAAAGAAACCCTACAAAT pLKO_005 1597 CDS 100% 13.200 6.600 Y Gm6871 n/a
5 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 925 CDS 100% 13.200 6.600 Y Zfp934 n/a
6 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 925 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
7 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 925 CDS 100% 13.200 6.600 Y EG668616 n/a
8 TRCN0000021908 TCAGGGATGTGGCCATAGAAT pLKO.1 115 5UTR 100% 5.625 2.813 Y ZNF765 n/a
9 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 3715 3UTR 100% 4.950 2.475 Y GJD4 n/a
10 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 3715 3UTR 100% 4.950 2.475 Y C9orf85 n/a
11 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 678 CDS 100% 4.950 2.475 Y ZNF28 n/a
12 TRCN0000148848 CATACAGGTGAGAAACCCTAT pLKO.1 2601 CDS 100% 4.050 2.025 Y ZNF260 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133474.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000478123 AGAAGATGTATCCTCCGGGTTGTT pLX_317 11.6% 35.9% 30.3% V5 (many diffs) n/a
2 ccsbBroadEn_14883 pDONR223 94% 35.9% 30.2% None (many diffs) n/a
3 ccsbBroad304_14883 pLX_304 0% 35.9% 30.2% V5 (many diffs) n/a
Download CSV