Transcript: Mouse NM_133729.2

Mus musculus serine/threonine kinase 26 (Stk26), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Stk26 (70415)
Length:
3335
CDS:
292..1542

Additional Resources:

NCBI RefSeq record:
NM_133729.2
NBCI Gene record:
Stk26 (70415)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146165 TTCACAAAATTAGAGCGCAT pXPR_003 TGG 86 7% 3 -0.3995 Stk26 STK26 75999
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133729.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276626 TGAATTGATCGATCGATTTAA pLKO_005 1146 CDS 100% 15.000 21.000 N Stk26 n/a
2 TRCN0000025280 CGAGAATAATGCGAGTCGAAA pLKO.1 1395 CDS 100% 4.950 6.930 N Stk26 n/a
3 TRCN0000025279 CCTGAATAAAGACCCGTCATT pLKO.1 1053 CDS 100% 4.950 3.960 N Stk26 n/a
4 TRCN0000276688 CCTGAATAAAGACCCGTCATT pLKO_005 1053 CDS 100% 4.950 3.960 N Stk26 n/a
5 TRCN0000276623 AGATTTAGAGGAAGCTATTAA pLKO_005 1670 3UTR 100% 15.000 10.500 N Stk26 n/a
6 TRCN0000025281 CCTGGGATGCAGAATAATATA pLKO.1 322 CDS 100% 15.000 10.500 N Stk26 n/a
7 TRCN0000276689 CCTGGGATGCAGAATAATATA pLKO_005 322 CDS 100% 15.000 10.500 N Stk26 n/a
8 TRCN0000025282 CAACTCTTATTGGAGACTTTA pLKO.1 1001 CDS 100% 13.200 9.240 N Stk26 n/a
9 TRCN0000025283 CACAGATAAGATGGTGAAGAA pLKO.1 1476 CDS 100% 4.950 3.465 N Stk26 n/a
10 TRCN0000285606 CACAGATAAGATGGTGAAGAA pLKO_005 1476 CDS 100% 4.950 3.465 N Stk26 n/a
11 TRCN0000003195 CTTAAACAGCAGGACGAGAAT pLKO.1 1381 CDS 100% 4.950 3.465 N STK26 n/a
12 TRCN0000320668 CTTAAACAGCAGGACGAGAAT pLKO_005 1381 CDS 100% 4.950 3.465 N STK26 n/a
13 TRCN0000196861 GCTCCTGAAGTTATTCAACAG pLKO.1 850 CDS 100% 4.050 2.835 N STK26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133729.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489362 TAACTTCACCGACTGAACCTGCCG pLX_317 23.4% 91.1% 98% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488583 CCTCGCAATGTAAACGGTGATGAG pLX_317 22.6% 91% 97.8% V5 (many diffs) n/a
3 TRCN0000488375 TTCTCACGTAATATCCGCCAGCGC pLX_317 28.3% 77.4% 83.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_12016 pDONR223 100% 28.5% 27.6% None (many diffs) n/a
5 ccsbBroad304_12016 pLX_304 0% 28.5% 27.6% V5 (many diffs) n/a
6 TRCN0000473372 CTCCGCCTCCTCGTCGTGTAGAGA pLX_317 100% 28.5% 27.6% V5 (many diffs) n/a
7 ccsbBroadEn_15074 pDONR223 0% 28.5% 27.6% None (many diffs) n/a
8 ccsbBroad304_15074 pLX_304 0% 28.5% 27.6% V5 (many diffs) n/a
9 TRCN0000474098 CTGAGGCAGCGTCGGCTATTCGCA pLX_317 90.9% 28.5% 27.6% V5 (many diffs) n/a
Download CSV