Transcript: Mouse NM_133898.4

Mus musculus NEDD4 binding protein 2-like 1 (N4bp2l1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
N4bp2l1 (100637)
Length:
1907
CDS:
90..806

Additional Resources:

NCBI RefSeq record:
NM_133898.4
NBCI Gene record:
N4bp2l1 (100637)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133898.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421316 GAGCTCTAAGTCCAGTGTAAA pLKO_005 893 3UTR 100% 13.200 18.480 N N4bp2l1 n/a
2 TRCN0000413470 ACGGTATGAACACAATGTTAC pLKO_005 605 CDS 100% 10.800 15.120 N N4bp2l1 n/a
3 TRCN0000421641 GAACAGAGGTCATTCTATTTA pLKO_005 935 3UTR 100% 15.000 12.000 N N4bp2l1 n/a
4 TRCN0000197812 GCTCTTGAGAATAACTATGAA pLKO.1 480 CDS 100% 5.625 4.500 N N4bp2l1 n/a
5 TRCN0000177658 CGCTGGAAATTCAACGTTCAA pLKO.1 525 CDS 100% 4.950 3.960 N N4bp2l1 n/a
6 TRCN0000435422 GAGACCTGAGCCGTCACTTTA pLKO_005 1250 3UTR 100% 13.200 9.240 N N4bp2l1 n/a
7 TRCN0000198746 CCAGGGTGATACAAGGAGATA pLKO.1 1601 3UTR 100% 4.950 3.465 N N4bp2l1 n/a
8 TRCN0000429934 GCTAATGGCCTCTACTCCAAC pLKO_005 747 CDS 100% 4.050 2.835 N N4bp2l1 n/a
9 TRCN0000197963 GTTAGCAAGAAGAAACATCCA pLKO.1 548 CDS 100% 2.640 1.848 N N4bp2l1 n/a
10 TRCN0000421810 GCCACCACCAAGGATATTAAT pLKO_005 787 CDS 100% 15.000 9.000 N N4bp2l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133898.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04524 pDONR223 100% 59.2% 50.3% None (many diffs) n/a
2 ccsbBroad304_04524 pLX_304 0% 59.2% 50.3% V5 (many diffs) n/a
3 TRCN0000466679 CAACCTTGGTTTGCCCGTACCTGC pLX_317 72.5% 59.2% 50.3% V5 (many diffs) n/a
Download CSV