Transcript: Mouse NM_133932.2

Mus musculus transcriptional adaptor 3 (Tada3), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Tada3 (101206)
Length:
1855
CDS:
224..1522

Additional Resources:

NCBI RefSeq record:
NM_133932.2
NBCI Gene record:
Tada3 (101206)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039292 GCCGACAACGAAGTCATGGAT pLKO.1 1382 CDS 100% 3.000 4.200 N Tada3 n/a
2 TRCN0000039291 CCTTACTGACTGGCAGGATAA pLKO.1 433 CDS 100% 10.800 8.640 N Tada3 n/a
3 TRCN0000039290 CCCAAGATCCAGGAATATGAA pLKO.1 605 CDS 100% 5.625 4.500 N Tada3 n/a
4 TRCN0000287469 CCCAAGATCCAGGAATATGAA pLKO_005 605 CDS 100% 5.625 4.500 N Tada3 n/a
5 TRCN0000294924 GCCAGAGGCTGCCTATCAAAT pLKO_005 1586 3UTR 100% 13.200 9.240 N Tada3 n/a
6 TRCN0000294925 GCGTGTACTGGAAGCTGAAAC pLKO_005 406 CDS 100% 10.800 7.560 N Tada3 n/a
7 TRCN0000294926 AGGACGATGGCATTGGCATTG pLKO_005 324 CDS 100% 6.000 4.200 N Tada3 n/a
8 TRCN0000039289 CCAGAAGATGAAGCTGAACAT pLKO.1 761 CDS 100% 4.950 3.465 N Tada3 n/a
9 TRCN0000287551 CCAGAAGATGAAGCTGAACAT pLKO_005 761 CDS 100% 4.950 3.465 N Tada3 n/a
10 TRCN0000015733 CCCAAGAAGCAGAAACTGGAA pLKO.1 524 CDS 100% 2.640 1.848 N TADA3 n/a
11 TRCN0000276387 CCCAAGAAGCAGAAACTGGAA pLKO_005 524 CDS 100% 2.640 1.848 N TADA3 n/a
12 TRCN0000039293 CCGCGCAATCAGAACAAGCCT pLKO.1 1118 CDS 100% 0.250 0.175 N Tada3 n/a
13 TRCN0000015734 GCTGTGGCTGACAAGAAGAAA pLKO.1 872 CDS 100% 5.625 3.375 N TADA3 n/a
14 TRCN0000285552 GCTGTGGCTGACAAGAAGAAA pLKO_005 872 CDS 100% 5.625 3.375 N TADA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02446 pDONR223 100% 90.3% 99.3% None (many diffs) n/a
2 ccsbBroad304_02446 pLX_304 0% 90.3% 99.3% V5 (many diffs) n/a
3 TRCN0000473532 CTGCATTGCTAAACTATGCTTGTC pLX_317 38.2% 90.2% 98.8% V5 (many diffs) n/a
4 ccsbBroadEn_15713 pDONR223 0% 77.1% 84.7% None (many diffs) n/a
5 TRCN0000472055 ACAGGACGCTACATGTCGTCCACG pLX_317 42.9% 77.1% 84.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV