Transcript: Mouse NM_133987.2

Mus musculus solute carrier family 6 (neurotransmitter transporter, creatine), member 8 (Slc6a8), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-18
Taxon:
Mus musculus (mouse)
Gene:
Slc6a8 (102857)
Length:
3992
CDS:
657..2579

Additional Resources:

NCBI RefSeq record:
NM_133987.2
NBCI Gene record:
Slc6a8 (102857)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133987.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370409 ATTACCTGGTCAAGTCCTTTA pLKO_005 1126 CDS 100% 10.800 15.120 N SLC6A8 n/a
2 TRCN0000043477 GATGAAATGGTGCTGGTCCTT pLKO.1 2225 CDS 100% 2.640 3.696 N SLC6A10P n/a
3 TRCN0000079861 GCAGCATCAATGTCTGGAACA pLKO.1 1012 CDS 100% 4.050 3.240 N Slc6a8 n/a
4 TRCN0000332078 GCAGCATCAATGTCTGGAACA pLKO_005 1012 CDS 100% 4.050 3.240 N Slc6a8 n/a
5 TRCN0000079858 CCCACAACTAAGCTGGTATTT pLKO.1 2806 3UTR 100% 13.200 9.240 N Slc6a8 n/a
6 TRCN0000377577 CTCAAGCCTGACTGGTCAAAG pLKO_005 1533 CDS 100% 10.800 7.560 N SLC6A8 n/a
7 TRCN0000079859 CGTGTACTTCACTGCTACATT pLKO.1 1436 CDS 100% 5.625 3.938 N Slc6a8 n/a
8 TRCN0000332016 CGTGTACTTCACTGCTACATT pLKO_005 1436 CDS 100% 5.625 3.938 N Slc6a8 n/a
9 TRCN0000043474 CATGGGCATCTTCATCTTCAA pLKO.1 2264 CDS 100% 4.950 3.465 N SLC6A10P n/a
10 TRCN0000042853 CCTACTACTTCCGTTTCCAAA pLKO.1 1963 CDS 100% 4.950 3.465 N SLC6A8 n/a
11 TRCN0000079860 CTCTCTTCTATGCTATGTGTA pLKO.1 2367 CDS 100% 4.950 3.465 N Slc6a8 n/a
12 TRCN0000332015 CTCTCTTCTATGCTATGTGTA pLKO_005 2367 CDS 100% 4.950 3.465 N Slc6a8 n/a
13 TRCN0000079862 CTACAACAACACCTACGTGTA pLKO.1 2309 CDS 100% 4.050 2.835 N Slc6a8 n/a
14 TRCN0000332079 CTACAACAACACCTACGTGTA pLKO_005 2309 CDS 100% 4.050 2.835 N Slc6a8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133987.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.