Transcript: Mouse NM_134157.2

Mus musculus ATPase, H+ transporting, lysosomal V1 subunit B1 (Atp6v1b1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Atp6v1b1 (110935)
Length:
1945
CDS:
69..1610

Additional Resources:

NCBI RefSeq record:
NM_134157.2
NBCI Gene record:
Atp6v1b1 (110935)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134157.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438117 TGTGGACCGACAGCTACATAA pLKO_005 1184 CDS 100% 13.200 18.480 N Atp6v1b1 n/a
2 TRCN0000437416 AGGGACTTCAGGGATTGATTC pLKO_005 350 CDS 100% 10.800 7.560 N Atp6v1b1 n/a
3 TRCN0000123879 CCTTCTCCTTTATGGCTTGAA pLKO.1 1629 3UTR 100% 4.950 3.465 N Atp6v1b1 n/a
4 TRCN0000123880 GCGCATCTTTCCGAAAGAGAT pLKO.1 1502 CDS 100% 4.950 3.465 N Atp6v1b1 n/a
5 TRCN0000123883 GTATGCTGAGATTGTCAACTT pLKO.1 251 CDS 100% 4.950 3.465 N Atp6v1b1 n/a
6 TRCN0000123881 CAAGTCAGATTTCGAGCAGAA pLKO.1 782 CDS 100% 4.050 2.835 N Atp6v1b1 n/a
7 TRCN0000123882 CGACTGATGAAGTCGGCCATA pLKO.1 1248 CDS 100% 0.405 0.284 N Atp6v1b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134157.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05872 pDONR223 100% 87.4% 93.7% None (many diffs) n/a
2 ccsbBroad304_05872 pLX_304 0% 87.4% 93.7% V5 (many diffs) n/a
3 TRCN0000479148 TGTTTATACTCTGTAATTGCCTAG pLX_317 29.8% 87.4% 93.7% V5 (many diffs) n/a
4 ccsbBroadEn_15365 pDONR223 0% 44.3% 46.3% None (many diffs) n/a
Download CSV