Transcript: Human NM_138403.5

Homo sapiens myosin light chain 10 (MYL10), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
MYL10 (93408)
Length:
1004
CDS:
179..859

Additional Resources:

NCBI RefSeq record:
NM_138403.5
NBCI Gene record:
MYL10 (93408)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138403.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430004 CGTCATCACTCACGGTGAAGA pLKO_005 829 CDS 100% 4.950 6.930 N MYL10 n/a
2 TRCN0000053604 GCACCGAGAAGAGCTCGGAAA pLKO.1 257 CDS 100% 0.135 0.189 N MYL10 n/a
3 TRCN0000053605 AGGCCGATGTCATCAAAGAAA pLKO.1 702 CDS 100% 5.625 3.938 N MYL10 n/a
4 TRCN0000104754 GAGGAGGTCAAGCAGATGTTT pLKO.1 755 CDS 100% 5.625 3.938 N Myl10 n/a
5 TRCN0000417461 CAAGCAGATGTTTGCAGCATT pLKO_005 763 CDS 100% 4.950 3.465 N MYL10 n/a
6 TRCN0000053603 CGACACTGAAGGGAAAGGTTT pLKO.1 676 CDS 100% 4.950 3.465 N MYL10 n/a
7 TRCN0000053606 GAGGACTTGAGGGACACCTTT pLKO.1 497 CDS 100% 4.950 3.465 N MYL10 n/a
8 TRCN0000418322 GCCGCATCAATGTCAAGAACG pLKO_005 528 CDS 100% 4.050 2.835 N MYL10 n/a
9 TRCN0000436773 TCCACGCCTTCAAAGTGTTCG pLKO_005 657 CDS 100% 4.050 2.835 N MYL10 n/a
10 TRCN0000053607 TGAAGGGAAAGGTTTCGTCAA pLKO.1 682 CDS 100% 4.050 2.835 N MYL10 n/a
11 TRCN0000427554 TTCAGTGAGGAGGAGGTCAAG pLKO_005 746 CDS 100% 4.050 2.835 N MYL10 n/a
12 TRCN0000436672 GACCCATCAACTTCACGGTGT pLKO_005 582 CDS 100% 2.160 1.512 N MYL10 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 236 CDS 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 236 CDS 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138403.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09357 pDONR223 100% 99.8% 100% None 603A>G n/a
2 ccsbBroad304_09357 pLX_304 0% 99.8% 100% V5 603A>G n/a
3 TRCN0000468365 CCGTCTTACGCATTTGTGTCGCAC pLX_317 60% 99.8% 100% V5 603A>G n/a
Download CSV