Transcript: Human NM_144695.4

Homo sapiens BRO1 domain and CAAX motif containing (BROX), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BROX (148362)
Length:
4104
CDS:
396..1631

Additional Resources:

NCBI RefSeq record:
NM_144695.4
NBCI Gene record:
BROX (148362)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144695.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265625 ATTTAGAGTCACGACTCATAG pLKO_005 916 CDS 100% 10.800 15.120 N BROX n/a
2 TRCN0000265630 GACCTGGACCAACAGTCAAAC pLKO_005 1282 CDS 100% 10.800 15.120 N BROX n/a
3 TRCN0000265642 GAATGCAGCAGATTCATATTT pLKO_005 569 CDS 100% 15.000 10.500 N BROX n/a
4 TRCN0000265634 AGCCTATACCTTTCGAATTTC pLKO_005 1450 CDS 100% 13.200 9.240 N BROX n/a
5 TRCN0000134917 CCTTGAACTGTTCACTGATTT pLKO.1 524 CDS 100% 13.200 9.240 N BROX n/a
6 TRCN0000265647 AGAAGTTCATCGAAGCCTAAA pLKO_005 818 CDS 100% 10.800 7.560 N BROX n/a
7 TRCN0000265629 CTTCACTTGAAGATGTGTTTC pLKO_005 1119 CDS 100% 10.800 7.560 N BROX n/a
8 TRCN0000265635 TAATGTAGCTTTATGGTATAC pLKO_005 743 CDS 100% 10.800 7.560 N BROX n/a
9 TRCN0000265628 TTCAAGTGGACTGATACATTG pLKO_005 663 CDS 100% 10.800 7.560 N BROX n/a
10 TRCN0000133775 CCAAGAAAGCAAGTTACGATA pLKO.1 632 CDS 100% 4.950 3.465 N BROX n/a
11 TRCN0000134743 GAGACTTTATTGGCTAGTGAT pLKO.1 1170 CDS 100% 4.950 3.465 N BROX n/a
12 TRCN0000134683 GTTATTCAATGTCAGGCTGAA pLKO.1 945 CDS 100% 4.050 2.835 N BROX n/a
13 TRCN0000134719 GCACTGTGTAAAGAATATGGA pLKO.1 1251 CDS 100% 3.000 2.100 N BROX n/a
14 TRCN0000135942 GTGATAAATGCGGTGAAGCAA pLKO.1 1186 CDS 100% 3.000 2.100 N BROX n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2255 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2255 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144695.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05013 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05013 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470606 TCCAAAATTTCTCGGTGCAACGGC pLX_317 31.3% 100% 100% V5 n/a
Download CSV