Transcript: Mouse NM_144829.1

Mus musculus alanyl-tRNA synthetase domain containing 1 (Aarsd1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Aarsd1 (69684)
Length:
1346
CDS:
46..1284

Additional Resources:

NCBI RefSeq record:
NM_144829.1
NBCI Gene record:
Aarsd1 (69684)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144829.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102505 GCTATCGAGCAGAGTGTCAAT pLKO.1 502 CDS 100% 4.950 6.930 N Aarsd1 n/a
2 TRCN0000327540 GCTATCGAGCAGAGTGTCAAT pLKO_005 502 CDS 100% 4.950 6.930 N Aarsd1 n/a
3 TRCN0000102507 GAGCGAAGTCATGGAAGTGAA pLKO.1 796 CDS 100% 4.950 3.960 N Aarsd1 n/a
4 TRCN0000327619 GAGCGAAGTCATGGAAGTGAA pLKO_005 796 CDS 100% 4.950 3.960 N Aarsd1 n/a
5 TRCN0000102508 GACCTTCAGGTCATTAAGATT pLKO.1 700 CDS 100% 5.625 3.938 N Aarsd1 n/a
6 TRCN0000327620 GACCTTCAGGTCATTAAGATT pLKO_005 700 CDS 100% 5.625 3.938 N Aarsd1 n/a
7 TRCN0000102509 GAAAGAAGTGTTGAGCGGATT pLKO.1 147 CDS 100% 4.050 2.835 N Aarsd1 n/a
8 TRCN0000327541 GAAAGAAGTGTTGAGCGGATT pLKO_005 147 CDS 100% 4.050 2.835 N Aarsd1 n/a
9 TRCN0000102506 CCGTGGTACCATCAATGACAT pLKO.1 225 CDS 100% 0.000 0.000 N Aarsd1 n/a
10 TRCN0000327539 CCGTGGTACCATCAATGACAT pLKO_005 225 CDS 100% 0.000 0.000 N Aarsd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144829.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09044 pDONR223 100% 68.3% 69.1% None (many diffs) n/a
2 ccsbBroad304_09044 pLX_304 0% 68.3% 69.1% V5 (many diffs) n/a
3 TRCN0000467834 ACAGACACAACCAACTTTGAGGAA pLX_317 28.9% 68.3% 69.1% V5 (many diffs) n/a
Download CSV