Transcript: Mouse NM_144909.1

Mus musculus glucokinase regulatory protein (Gckr), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Gckr (231103)
Length:
2024
CDS:
40..1803

Additional Resources:

NCBI RefSeq record:
NM_144909.1
NBCI Gene record:
Gckr (231103)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088669 CCTCGGTATCATCGCCATTAT pLKO.1 1050 CDS 100% 13.200 18.480 N Gckr n/a
2 TRCN0000362776 TGCCATCCCTTACGGAAATTG pLKO_005 1229 CDS 100% 13.200 18.480 N Gckr n/a
3 TRCN0000362707 CCCTCGGTATCATCGCCATTA pLKO_005 1049 CDS 100% 10.800 15.120 N Gckr n/a
4 TRCN0000088670 GCCAGAAATGATCCCATTGAA pLKO.1 679 CDS 100% 5.625 7.875 N Gckr n/a
5 TRCN0000088672 CGGAACTTGGACAAAGCAGAT pLKO.1 154 CDS 100% 4.050 5.670 N Gckr n/a
6 TRCN0000088668 CCAGTAATACACGTTGCAGGA pLKO.1 1859 3UTR 100% 2.160 3.024 N Gckr n/a
7 TRCN0000362777 TGGTGCTGATTTCCGAGATAT pLKO_005 1098 CDS 100% 13.200 9.240 N Gckr n/a
8 TRCN0000362706 AGTGGTCGTTATAGGCATTTC pLKO_005 555 CDS 100% 10.800 7.560 N Gckr n/a
9 TRCN0000088671 GCTCCTCTAAAGAAGCTCTTT pLKO.1 1378 CDS 100% 4.950 3.465 N Gckr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06266 pDONR223 100% 80.4% 81.8% None (many diffs) n/a
2 ccsbBroad304_06266 pLX_304 0% 80.4% 81.8% V5 (many diffs) n/a
3 TRCN0000466542 GAGATCCCGATCTCGGATACACAG pLX_317 19.1% 80.4% 81.8% V5 (many diffs) n/a
Download CSV