Transcript: Mouse NM_145100.4

Mus musculus Ly6/Plaur domain containing 1 (Lypd1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Lypd1 (72585)
Length:
6480
CDS:
325..750

Additional Resources:

NCBI RefSeq record:
NM_145100.4
NBCI Gene record:
Lypd1 (72585)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145100.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175231 CCTTTCAAGTAACGCAAGATT pLKO.1 870 3UTR 100% 5.625 7.875 N Lypd1 n/a
2 TRCN0000176357 CATCGTAAATTGCACCGTGAA pLKO.1 450 CDS 100% 4.050 5.670 N Lypd1 n/a
3 TRCN0000176058 GTAAATTGCACCGTGAACGTT pLKO.1 454 CDS 100% 3.000 4.200 N Lypd1 n/a
4 TRCN0000257019 TTCAAGACATGTGTCAGAAAG pLKO_005 473 CDS 100% 10.800 7.560 N LYPD1 n/a
5 TRCN0000193888 CAGAAAGAAGTGATGGAGCAA pLKO.1 487 CDS 100% 2.640 1.848 N Lypd1 n/a
6 TRCN0000173852 CAGCTGAACAACGATTGCTCA pLKO.1 418 CDS 100% 2.640 1.848 N Lypd1 n/a
7 TRCN0000175272 CATGTGTCAGAAAGAAGTGAT pLKO.1 480 CDS 100% 4.950 2.970 N Lypd1 n/a
8 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 4682 3UTR 100% 2.640 1.320 Y Adsl n/a
9 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 4682 3UTR 100% 2.640 1.320 Y Adsl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145100.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04707 pDONR223 100% 89.5% 93.6% None (many diffs) n/a
2 ccsbBroad304_04707 pLX_304 0% 89.5% 93.6% V5 (many diffs) n/a
3 TRCN0000472745 CTGCCTTCCTTTAATCGCCCGGGA pLX_317 100% 89.5% 93.6% V5 (many diffs) n/a
4 TRCN0000491458 AGGGCGAGTATAGAGCTCCTGACC pLX_317 83.6% 89.5% 93.6% V5 (many diffs) n/a
5 TRCN0000488478 TATGCCAAGTCCGTCCATCTTCCA pLX_317 86.9% 89.5% 93.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV