Transcript: Human NM_145109.3

Homo sapiens mitogen-activated protein kinase kinase 3 (MAP2K3), transcript variant B, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MAP2K3 (5606)
Length:
2256
CDS:
211..1254

Additional Resources:

NCBI RefSeq record:
NM_145109.3
NBCI Gene record:
MAP2K3 (5606)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147291 AAGCTGTCGGTGATCCACAG pXPR_003 AGG 563 54% 7 0.9232 MAP2K3 MAP2K3 76379
2 BRDN0001147239 CTTGGACAAGTTCTACCGGA pXPR_003 AGG 454 43% 6 0.5358 MAP2K3 MAP2K3 76381
3 BRDN0001146677 TTGGTGACCATCTCAGAACT pXPR_003 GGG 206 20% 4 0.4598 MAP2K3 MAP2K3 76380
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145109.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356084 CTCTCGACTGAATGGACTTTG pLKO_005 1650 3UTR 100% 10.800 15.120 N MAP2K3 n/a
2 TRCN0000009975 CGGACCTTCATCACCATTGGA pLKO.1 349 CDS 100% 3.000 4.200 N MAP2K3 n/a
3 TRCN0000199894 GCGAGCCATTTGTCCCAAGTG pLKO.1 1401 3UTR 100% 1.350 1.080 N MAP2K3 n/a
4 TRCN0000356056 GGATGCCATCCAAGTTGTATA pLKO_005 1619 3UTR 100% 13.200 9.240 N MAP2K3 n/a
5 TRCN0000199996 CTACCGGAAGGTGCTGGATAA pLKO.1 660 CDS 100% 10.800 7.560 N MAP2K3 n/a
6 TRCN0000377263 TGAACCAGAAGGGCTACAATG pLKO_005 929 CDS 100% 10.800 7.560 N MAP2K3 n/a
7 TRCN0000219709 TATCGGTGTCATTCACCTTTC pLKO.1 1862 3UTR 100% 6.000 4.200 N MAP2K3 n/a
8 TRCN0000219710 CTTTATGGGTTTGGCTTGTTT pLKO.1 1923 3UTR 100% 5.625 3.938 N MAP2K3 n/a
9 TRCN0000009986 GCCCTCCAATGTCCTTATCAA pLKO.1 786 CDS 100% 5.625 3.938 N MAP2K3 n/a
10 TRCN0000199303 CACAGCAAGCTGTCGGTGATC pLKO.1 751 CDS 100% 1.350 0.945 N MAP2K3 n/a
11 TRCN0000009974 CATCCTGCGGTTCCCTTACGA pLKO.1 996 CDS 100% 1.000 0.700 N MAP2K3 n/a
12 TRCN0000009985 ATTGCTGTGTCTATCGTGCGG pLKO.1 715 CDS 100% 0.540 0.378 N MAP2K3 n/a
13 TRCN0000356083 TACCGGAAGGTGCTGGATAAA pLKO_005 661 CDS 100% 0.000 0.000 N MAP2K3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145109.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489556 AAGAAAAGCCACTTGGCTTATTAC pLX_317 33.7% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000487771 AGGTAAGGCCGTCACGACATAATA pLX_317 24.5% 99.9% 99.7% V5 1041_1042insG n/a
3 TRCN0000491799 CTGCAATTATTATATTTTCTCCAT pLX_317 33.8% 99.9% 100% V5 (not translated due to prior stop codon) 360T>C n/a
4 TRCN0000488689 GGTGCGCGACCTCAATGTCACGTG pLX_317 36.2% 91.4% 91.3% V5 1_87del;360T>C;1041_1042insG n/a
5 TRCN0000487949 TACCATGCTTCGTGATAAGCGCGT pLX_317 26.9% 91.4% 91% V5 (not translated due to prior stop codon) 1_87del;966C>A;1021G>A n/a
Download CSV