Transcript: Human NM_145201.6

Homo sapiens nicotinate phosphoribosyltransferase (NAPRT), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
NAPRT (93100)
Length:
1682
CDS:
13..1629

Additional Resources:

NCBI RefSeq record:
NM_145201.6
NBCI Gene record:
NAPRT (93100)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145201.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242730 CACCATGGCGTTGGGCTATTG pLKO_005 81 CDS 100% 3.600 5.040 N NAPRT n/a
2 TRCN0000242727 GCAGTGAGGTGAATGTCATTG pLKO_005 1121 CDS 100% 10.800 8.640 N NAPRT n/a
3 TRCN0000180305 CCTCATCGTAGTCAGCAACAA pLKO.1 1062 CDS 100% 4.950 3.960 N NAPRT n/a
4 TRCN0000242731 TTCCCTGGGTGGCGTCTATAA pLKO_005 1179 CDS 100% 13.200 9.240 N NAPRT n/a
5 TRCN0000242728 CTCATGGACATGCTGCAGTTA pLKO_005 1312 CDS 100% 4.950 3.465 N NAPRT n/a
6 TRCN0000110254 CCTGCGTTCTTCGAGCACCTT pLKO.1 280 CDS 100% 0.880 0.616 N Naprt n/a
7 TRCN0000242729 GTCAGTCCTCATCGTAGTCAG pLKO_005 1056 CDS 100% 4.050 2.430 N NAPRT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145201.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12989 pDONR223 100% 95.4% 95.5% None 1_72del;913C>T n/a
2 ccsbBroad304_12989 pLX_304 0% 95.4% 95.5% V5 1_72del;913C>T n/a
3 TRCN0000470480 TGCTCCCTCGAACATTCTGATGCA pLX_317 29% 95.4% 95.5% V5 1_72del;913C>T n/a
4 ccsbBroadEn_16068 pDONR223 0% 85.7% 85.6% None (many diffs) n/a
5 ccsbBroad304_16068 pLX_304 0% 85.7% 85.6% V5 (many diffs) n/a
6 ccsbBroadEn_14345 pDONR223 100% 57.4% 57.4% None (many diffs) n/a
7 ccsbBroad304_14345 pLX_304 0% 57.4% 57.4% V5 (many diffs) n/a
8 TRCN0000474285 ACTCTCGTCCCGACTAAGGTTCTT pLX_317 47.7% 57.4% 57.4% V5 (many diffs) n/a
Download CSV