Transcript: Mouse NM_145501.2

Mus musculus phosphatidylinositol 4-kinase type 2 alpha (Pi4k2a), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Pi4k2a (84095)
Length:
3771
CDS:
68..1507

Additional Resources:

NCBI RefSeq record:
NM_145501.2
NBCI Gene record:
Pi4k2a (84095)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146736 GGGTCACTGACCTTTGTACG pXPR_003 TGG 630 44% 2 0.1501 Pi4k2a PI4K2A 76821
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025581 ACCACGTACAAAGGTAGTATA pLKO.1 691 CDS 100% 13.200 18.480 N Pi4k2a n/a
2 TRCN0000427685 GCCCTTAATCTAGAACCTAAA pLKO_005 1934 3UTR 100% 10.800 15.120 N Pi4k2a n/a
3 TRCN0000412506 TACGGGCACCTTAACCCTAAG pLKO_005 542 CDS 100% 6.000 8.400 N Pi4k2a n/a
4 TRCN0000424213 CATCTATCCCGAGCGCATCTA pLKO_005 439 CDS 100% 4.950 6.930 N Pi4k2a n/a
5 TRCN0000025583 GCTATTGCAGTTTGAGCGGTT pLKO.1 937 CDS 100% 2.160 3.024 N Pi4k2a n/a
6 TRCN0000419847 TCTTCGTTGAAGGCTACAAAG pLKO_005 852 CDS 100% 10.800 8.640 N Pi4k2a n/a
7 TRCN0000025582 CCAGGCCCTGAAAGACAATAA pLKO.1 1360 CDS 100% 13.200 9.240 N Pi4k2a n/a
8 TRCN0000196779 GCTACAAAGATGCAGACTATT pLKO.1 864 CDS 100% 13.200 9.240 N PI4K2A n/a
9 TRCN0000414366 AGTGCCATTGATCGAGTAAAG pLKO_005 737 CDS 100% 10.800 7.560 N Pi4k2a n/a
10 TRCN0000025579 CCGTTCTCTCAGGAGATCAAA pLKO.1 1190 CDS 100% 5.625 3.938 N Pi4k2a n/a
11 TRCN0000037605 CCATAAGCAGATTGCTGTCAT pLKO.1 1315 CDS 100% 4.950 3.465 N PI4K2A n/a
12 TRCN0000434240 ACTACATCATCCGCAACACTG pLKO_005 969 CDS 100% 4.050 2.835 N Pi4k2a n/a
13 TRCN0000025580 CCCAAGAATGAAGAGCCATAT pLKO.1 524 CDS 100% 10.800 7.560 N Pi4k2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489329 GGCCTGCTGGTGCCCCCTTCCTGT pLX_317 23.2% 91.9% 95.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_15098 pDONR223 100% 84% 42.3% None (many diffs) n/a
3 ccsbBroad304_15098 pLX_304 0% 84% 42.3% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000471517 AGGTACACGGCAGCGATACGACCT pLX_317 27.2% 84% 42.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV