Transcript: Mouse NM_145505.4

Mus musculus family with sequence similarity 160, member B1 (Fam160b1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Fam160b1 (226252)
Length:
5630
CDS:
318..2612

Additional Resources:

NCBI RefSeq record:
NM_145505.4
NBCI Gene record:
Fam160b1 (226252)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145505.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375168 TGGGACTCGAATGCTTATATT pLKO_005 2933 3UTR 100% 15.000 21.000 N Fam160b1 n/a
2 TRCN0000217759 CCTCTAAGACATAGGTTAATC pLKO.1 1668 CDS 100% 13.200 18.480 N Fam160b1 n/a
3 TRCN0000345593 TCGAACATTGCGATCACATAT pLKO_005 1687 CDS 100% 13.200 18.480 N Fam160b1 n/a
4 TRCN0000178505 CCTTTGTTAAGTACCACGCTT pLKO.1 2578 CDS 100% 2.640 2.112 N Fam160b1 n/a
5 TRCN0000197576 CTGGAGGAAGATCCATTATTT pLKO.1 1890 CDS 100% 15.000 10.500 N Fam160b1 n/a
6 TRCN0000345523 TCTGGAGGAAGATCCATTATT pLKO_005 1889 CDS 100% 15.000 10.500 N Fam160b1 n/a
7 TRCN0000215724 CAAGATCTTGGAAACGTTATA pLKO.1 572 CDS 100% 13.200 9.240 N Fam160b1 n/a
8 TRCN0000178029 GCCAGAAACTCTGTCAGAAAT pLKO.1 1637 CDS 100% 13.200 9.240 N Fam160b1 n/a
9 TRCN0000345522 GCCAGAAACTCTGTCAGAAAT pLKO_005 1637 CDS 100% 13.200 9.240 N Fam160b1 n/a
10 TRCN0000375169 ACAAGATCTTGGAAACGTTAT pLKO_005 571 CDS 100% 10.800 7.560 N Fam160b1 n/a
11 TRCN0000345590 AGGTTAAGATTCTTATCATAC pLKO_005 3006 3UTR 100% 10.800 7.560 N Fam160b1 n/a
12 TRCN0000178174 GATCCCTACTTGGTCAACTTT pLKO.1 810 CDS 100% 5.625 3.938 N Fam160b1 n/a
13 TRCN0000177292 GCGATTACACACTACTACATA pLKO.1 411 CDS 100% 5.625 3.938 N Fam160b1 n/a
14 TRCN0000198094 CCAGGACTACAACTTAGTGAA pLKO.1 1085 CDS 100% 4.950 2.970 N Fam160b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145505.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08761 pDONR223 100% 80.5% 88.3% None (many diffs) n/a
2 ccsbBroad304_08761 pLX_304 0% 80.5% 88.3% V5 (many diffs) n/a
3 TRCN0000465820 TTCTAATCCAAGTCATCCATAGCT pLX_317 19.7% 80.5% 88.3% V5 (many diffs) n/a
Download CSV