Transcript: Mouse NM_145833.1

Mus musculus lin-28 homolog A (C. elegans) (Lin28a), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Lin28a (83557)
Length:
3480
CDS:
76..705

Additional Resources:

NCBI RefSeq record:
NM_145833.1
NBCI Gene record:
Lin28a (83557)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145833.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102575 CCCAGTAAGAATGCAACTTAA pLKO.1 2017 3UTR 100% 13.200 9.240 N Lin28a n/a
2 TRCN0000426867 TAGAAGGCTGTGTGATATTTC pLKO_005 995 3UTR 100% 13.200 9.240 N Lin28a n/a
3 TRCN0000416746 GAAGCGAAACAAGTGTCAAAC pLKO_005 1029 3UTR 100% 10.800 7.560 N Lin28a n/a
4 TRCN0000436889 CTCCCAGAAGCCCAGAATTGA pLKO_005 685 CDS 100% 5.625 3.938 N Lin28a n/a
5 TRCN0000102578 CAAAGGAGACAGGTGCTACAA pLKO.1 477 CDS 100% 4.950 3.465 N Lin28a n/a
6 TRCN0000102577 CACCTTTAAGAAGTCTGCCAA pLKO.1 360 CDS 100% 2.640 1.848 N Lin28a n/a
7 TRCN0000102579 CATCTGTAAGTGGTTCAACGT pLKO.1 201 CDS 100% 2.640 1.848 N Lin28a n/a
8 TRCN0000102576 CCAGCCCAAGAAGTGCCACTT pLKO.1 543 CDS 100% 1.350 0.810 N Lin28a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145833.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04116 pDONR223 100% 91% 96.6% None (many diffs) n/a
2 ccsbBroad304_04116 pLX_304 0% 91% 96.6% V5 (many diffs) n/a
3 TRCN0000474198 ACGACCAATATGTACTAAATTCTT pLX_317 74% 90.9% 32% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV