Transcript: Mouse NM_146257.2

Mus musculus solute carrier family 29 (nucleoside transporters), member 4 (Slc29a4), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Slc29a4 (243328)
Length:
2942
CDS:
203..1789

Additional Resources:

NCBI RefSeq record:
NM_146257.2
NBCI Gene record:
Slc29a4 (243328)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146257.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079754 CCCTTGCTCTTTATCAGCATA pLKO.1 638 CDS 100% 4.950 6.930 N Slc29a4 n/a
2 TRCN0000079755 CGACTATCTTCACCACAAGTA pLKO.1 478 CDS 100% 4.950 6.930 N Slc29a4 n/a
3 TRCN0000418487 TGGTGACAAGCTTTAGCTTTG pLKO_005 267 CDS 100% 6.000 4.200 N Slc29a4 n/a
4 TRCN0000079757 GTGTTCAACCTGTCAGACTTT pLKO.1 1367 CDS 100% 4.950 3.465 N Slc29a4 n/a
5 TRCN0000079756 GCAATCTAGCTTCTATGGCTA pLKO.1 751 CDS 100% 2.640 1.848 N Slc29a4 n/a
6 TRCN0000437384 ACTTTCACAGACTCTGCGGTA pLKO_005 356 CDS 100% 2.160 1.512 N Slc29a4 n/a
7 TRCN0000425589 GCTCAGGATCCAGGCATCAGA pLKO_005 320 CDS 100% 1.000 0.700 N Slc29a4 n/a
8 TRCN0000079753 CCTCCCTGTATTAGAAATCTT pLKO.1 2192 3UTR 100% 5.625 3.375 N Slc29a4 n/a
9 TRCN0000436135 CTGACCAGAGTGTGGTGACAA pLKO_005 255 CDS 100% 4.950 2.970 N Slc29a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146257.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489419 ATGACAAGACAACCAGGTTGATTC pLX_317 21.2% 83.5% 86.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_13440 pDONR223 100% 81.2% 78.8% None (many diffs) n/a
3 ccsbBroad304_13440 pLX_304 0% 81.2% 78.8% V5 (many diffs) n/a
4 TRCN0000469666 CTCTACGCATCGAGTATTAGCCCC pLX_317 17.4% 81.2% 78.8% V5 (many diffs) n/a
Download CSV