Transcript: Human NM_148977.2

Homo sapiens pantothenate kinase 1 (PANK1), transcript variant alpha, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
PANK1 (53354)
Length:
6976
CDS:
271..2067

Additional Resources:

NCBI RefSeq record:
NM_148977.2
NBCI Gene record:
PANK1 (53354)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_148977.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197214 GCGCGTTGAATGAGAACATAG pLKO.1 1868 CDS 100% 10.800 15.120 N PANK1 n/a
2 TRCN0000197255 GCTATGCACAGGTTCATTCAG pLKO.1 1216 CDS 100% 4.950 6.930 N PANK1 n/a
3 TRCN0000199686 GCCTGCTTTATGTCGACTCTG pLKO.1 1379 CDS 100% 4.050 5.670 N PANK1 n/a
4 TRCN0000037561 GCCTTGATAACCCATACCCTA pLKO.1 1478 CDS 100% 2.640 3.696 N PANK1 n/a
5 TRCN0000194665 CCTATGTTGCTGGTTAACATG pLKO.1 1495 CDS 100% 0.495 0.693 N PANK1 n/a
6 TRCN0000037563 GCTGGCATATGCCATGGATTT pLKO.1 1944 CDS 100% 0.000 0.000 N PANK1 n/a
7 TRCN0000037560 CGCTGGTTAAATTGGTGTATT pLKO.1 1007 CDS 100% 13.200 10.560 N PANK1 n/a
8 TRCN0000196696 GTTTGTCCTATCGCTTATAAA pLKO.1 2829 3UTR 100% 15.000 10.500 N PANK1 n/a
9 TRCN0000361881 TTTGGAACATGAGGGTTATTT pLKO_005 1995 CDS 100% 15.000 10.500 N Pank1 n/a
10 TRCN0000424569 AGTAATTACTCTAGGAGATTT pLKO_005 2446 3UTR 100% 13.200 9.240 N PANK1 n/a
11 TRCN0000428890 TGAAGAGCATCCGGAAGTATT pLKO_005 1079 CDS 100% 13.200 9.240 N PANK1 n/a
12 TRCN0000037559 CCCTACCTGTAACCTTTCTTT pLKO.1 2660 3UTR 100% 5.625 3.938 N PANK1 n/a
13 TRCN0000037562 CCGAAGGATATTACAGCCGAA pLKO.1 1033 CDS 100% 2.160 1.512 N PANK1 n/a
14 TRCN0000195062 CGGAAGTATTTGACTTCTAAT pLKO.1 1090 CDS 100% 1.320 0.792 N PANK1 n/a
15 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4779 3UTR 100% 4.950 2.475 Y ERAP2 n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4780 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_148977.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12021 pDONR223 100% 22.9% 22.9% None 1_1383del n/a
2 ccsbBroad304_12021 pLX_304 0% 22.9% 22.9% V5 1_1383del n/a
3 TRCN0000475014 CCGGATTTTAACCCTTCACTGAGC pLX_317 100% 22.9% 22.9% V5 1_1383del n/a
4 TRCN0000487959 CGACCGATTATTCACTTTGCAAAA pLX_317 72% 22.9% 22.9% V5 (not translated due to prior stop codon) 1_1383del n/a
Download CSV