Transcript: Human NM_152557.5

Homo sapiens zinc finger protein 746 (ZNF746), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ZNF746 (155061)
Length:
3896
CDS:
274..2208

Additional Resources:

NCBI RefSeq record:
NM_152557.5
NBCI Gene record:
ZNF746 (155061)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152557.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433884 GAAATGGGAGCGCCGTAGAAT pLKO_005 2406 3UTR 100% 5.625 7.875 N ZNF746 n/a
2 TRCN0000157931 CGTACATCCTACTGACCTAGA pLKO.1 1167 CDS 100% 4.050 5.670 N ZNF746 n/a
3 TRCN0000156664 GCTGGAATTTCCGGTGTAAAC pLKO.1 1412 CDS 100% 10.800 7.560 N ZNF746 n/a
4 TRCN0000425896 ATTCCGGAGCAGGAGACATCT pLKO_005 947 CDS 100% 4.950 3.465 N ZNF746 n/a
5 TRCN0000158170 CTCTGGTGTCCATTCCAACTT pLKO.1 981 CDS 100% 4.950 3.465 N ZNF746 n/a
6 TRCN0000157534 GCCATTCAACGAACCCTGTAA pLKO.1 1530 CDS 100% 4.950 3.465 N ZNF746 n/a
7 TRCN0000154566 GCTTGTTCATTCCAGCATCTA pLKO.1 3473 3UTR 100% 4.950 3.465 N ZNF746 n/a
8 TRCN0000156627 GCCTCAAAGGAACTTCTGCTT pLKO.1 3363 3UTR 100% 2.640 1.848 N ZNF746 n/a
9 TRCN0000156880 GCCATGGAGAGGAAGATTGAA pLKO.1 331 CDS 100% 5.625 2.813 Y ZNF746 n/a
10 TRCN0000165273 GCCATGGAGAGGAAGATTGAA pLKO.1 331 CDS 100% 5.625 2.813 Y ZNF767P n/a
11 TRCN0000319069 GCCATGGAGAGGAAGATTGAA pLKO_005 331 CDS 100% 5.625 2.813 Y ZNF767P n/a
12 TRCN0000164872 GTCCTCTCCCAGATTGAACAA pLKO.1 703 CDS 100% 4.950 2.475 Y ZNF767P n/a
13 TRCN0000166811 CAGATTGAACAAGGGAAGGAG pLKO.1 712 CDS 100% 2.640 1.320 Y ZNF767P n/a
14 TRCN0000166493 CCAGATTGAACAAGGGAAGGA pLKO.1 711 CDS 100% 2.640 1.320 Y ZNF767P n/a
15 TRCN0000318995 CCAGATTGAACAAGGGAAGGA pLKO_005 711 CDS 100% 2.640 1.320 Y ZNF767P n/a
16 TRCN0000165089 GATTCCAGATGTTCCTGTGGA pLKO.1 762 CDS 100% 2.640 1.320 Y ZNF767P n/a
17 TRCN0000318996 GATTCCAGATGTTCCTGTGGA pLKO_005 762 CDS 100% 2.640 1.320 Y ZNF767P n/a
18 TRCN0000179737 CAACAGGAACTTCTGGATCTT pLKO.1 540 CDS 100% 4.950 2.475 Y LOC155060 n/a
19 TRCN0000164751 CTGCTTTCCCTAGAAGGTCAA pLKO.1 367 CDS 100% 4.050 2.025 Y ZNF767P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152557.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10522 pDONR223 100% 17.5% 16.4% None (many diffs) n/a
2 ccsbBroad304_10522 pLX_304 0% 17.5% 16.4% V5 (many diffs) n/a
3 TRCN0000466099 CTGACAACCTTTTAGAATTATCCT pLX_317 100% 17.5% 16.4% V5 (many diffs) n/a
Download CSV