Transcript: Human NM_152594.3

Homo sapiens sprouty related EVH1 domain containing 1 (SPRED1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SPRED1 (161742)
Length:
7270
CDS:
351..1685

Additional Resources:

NCBI RefSeq record:
NM_152594.3
NBCI Gene record:
SPRED1 (161742)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152594.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066313 GCACAGATGTAATTGTCTAAT pLKO.1 2477 3UTR 100% 13.200 18.480 N Spred1 n/a
2 TRCN0000312144 GCACAGATGTAATTGTCTAAT pLKO_005 2477 3UTR 100% 13.200 18.480 N Spred1 n/a
3 TRCN0000313075 GAACGTTCTCGCTGCGTATAC pLKO_005 1341 CDS 100% 10.800 15.120 N Spred1 n/a
4 TRCN0000438610 GAACGTTCTCGCTGCGTATAC pLKO_005 1341 CDS 100% 10.800 15.120 N SPRED1 n/a
5 TRCN0000056712 GAGCATGTTGTATCATTGTAT pLKO.1 1469 CDS 100% 5.625 7.875 N SPRED1 n/a
6 TRCN0000056711 CGCTATGCAGACTACAGACAT pLKO.1 1119 CDS 100% 4.950 6.930 N SPRED1 n/a
7 TRCN0000414271 GAATCTTGCCTGGTATCATTG pLKO_005 1773 3UTR 100% 10.800 8.640 N SPRED1 n/a
8 TRCN0000056710 GCCTTATAGAAGCTCAAATAT pLKO.1 848 CDS 100% 15.000 10.500 N SPRED1 n/a
9 TRCN0000417109 GAATACGTACAGCGGCAAATA pLKO_005 978 CDS 100% 13.200 9.240 N SPRED1 n/a
10 TRCN0000056708 GCAGATGACTTACAAGCAAAT pLKO.1 759 CDS 100% 10.800 7.560 N SPRED1 n/a
11 TRCN0000056709 GCCAAGCCAATCAGATAACAT pLKO.1 919 CDS 100% 5.625 3.938 N SPRED1 n/a
12 TRCN0000066317 GTCCCTCATCAGGAAGAGAAT pLKO.1 489 CDS 100% 4.950 3.465 N Spred1 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5234 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5234 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152594.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09737 pDONR223 100% 99.8% 100% None 291G>A;1044T>C n/a
2 ccsbBroad304_09737 pLX_304 0% 99.8% 100% V5 291G>A;1044T>C n/a
3 TRCN0000481551 CCATCTGTTACCGTGTTGTCGAAA pLX_317 33.7% 99.8% 100% V5 291G>A;1044T>C n/a
Download CSV