Transcript: Human NM_152697.5

Homo sapiens solute carrier family 44 member 5 (SLC44A5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
SLC44A5 (204962)
Length:
4436
CDS:
145..2304

Additional Resources:

NCBI RefSeq record:
NM_152697.5
NBCI Gene record:
SLC44A5 (204962)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152697.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413254 ATGGTCCTTAGTTGGATATTT pLKO_005 901 CDS 100% 15.000 21.000 N SLC44A5 n/a
2 TRCN0000434300 ATACTTGGACCACCGTCTTAA pLKO_005 1746 CDS 100% 13.200 18.480 N SLC44A5 n/a
3 TRCN0000160276 CCAGAACACATTGTCTAAATT pLKO.1 1773 CDS 100% 15.000 10.500 N SLC44A5 n/a
4 TRCN0000161797 CTGGTGCATTCGCTACTTATT pLKO.1 1583 CDS 100% 13.200 9.240 N SLC44A5 n/a
5 TRCN0000159959 GCAACAAACATGGTTCACATT pLKO.1 1107 CDS 100% 4.950 3.465 N SLC44A5 n/a
6 TRCN0000163766 GCACTCCCAATGAGAACAAGA pLKO.1 392 CDS 100% 4.950 3.465 N SLC44A5 n/a
7 TRCN0000159726 GCACTTTAACAATAGGAAGTA pLKO.1 716 CDS 100% 4.950 3.465 N SLC44A5 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4143 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000162397 CACAAGGACCAGCATCTTTAT pLKO.1 2063 CDS 100% 13.200 9.240 N SLC44A5 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4144 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152697.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09832 pDONR223 100% 99.8% 99.8% None (many diffs) n/a
2 ccsbBroad304_09832 pLX_304 0% 99.8% 99.8% V5 (many diffs) n/a
3 TRCN0000469094 TCAGACATTCCTATTACTAAGATC pLX_317 19.6% 99.8% 99.8% V5 (many diffs) n/a
Download CSV