Transcript: Mouse NM_152809.2

Mus musculus casein kinase 1, gamma 3 (Csnk1g3), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Csnk1g3 (70425)
Length:
4394
CDS:
735..2009

Additional Resources:

NCBI RefSeq record:
NM_152809.2
NBCI Gene record:
Csnk1g3 (70425)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_152809.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338169 TAATGGTTGGACCTAACTTTA pLKO_005 844 CDS 100% 13.200 18.480 N CSNK1G3 n/a
2 TRCN0000023817 GCACTCGAGGAACTGGGTCTT pLKO.1 808 CDS 100% 0.000 0.000 N Csnk1g3 n/a
3 TRCN0000427659 ATGAATATGTGGCGATTAAAC pLKO_005 931 CDS 100% 13.200 9.240 N Csnk1g3 n/a
4 TRCN0000023766 CCACTCAAAGAACTTGATATA pLKO.1 1193 CDS 100% 13.200 9.240 N Csnk1g3 n/a
5 TRCN0000023765 GCAGAGTAGAAGAGATGATTT pLKO.1 1409 CDS 100% 13.200 9.240 N Csnk1g3 n/a
6 TRCN0000432085 GACGGTCGAATGCACCCATTA pLKO_005 1873 CDS 100% 10.800 7.560 N Csnk1g3 n/a
7 TRCN0000420971 TAGGATCTGGAGATGGTATAC pLKO_005 1012 CDS 100% 10.800 7.560 N Csnk1g3 n/a
8 TRCN0000023767 CCAGCAAGTCATTCATATCAT pLKO.1 1265 CDS 100% 5.625 3.938 N Csnk1g3 n/a
9 TRCN0000023768 GACGAGACAAACTGCCAGAAA pLKO.1 1920 CDS 100% 4.950 3.465 N Csnk1g3 n/a
10 TRCN0000023818 TGGGTCTTCTTCATCTGGAGT pLKO.1 821 CDS 100% 2.640 1.848 N Csnk1g3 n/a
11 TRCN0000023764 CCAGGTTGTAAGTTCTACAAA pLKO.1 1820 CDS 100% 0.563 0.338 N Csnk1g3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152809.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06057 pDONR223 100% 92.3% 98.5% None (many diffs) n/a
2 ccsbBroad304_06057 pLX_304 0% 92.3% 98.5% V5 (many diffs) n/a
3 TRCN0000477806 CGATTTGCAATTGATGCTTGGCAT pLX_317 26.7% 92.3% 98.5% V5 (many diffs) n/a
4 ccsbBroadEn_14603 pDONR223 100% 92.2% 98.3% None (many diffs) n/a
5 ccsbBroad304_14603 pLX_304 0% 92.2% 98.3% V5 (many diffs) n/a
6 TRCN0000467288 CGAATTGCCCCTTACTCTATAGGA pLX_317 11.6% 92.2% 98.3% V5 (many diffs) n/a
7 TRCN0000489721 TTAGACGGACATTGTATCAGTATC pLX_317 94.5% 25.2% 22.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV