Transcript: Human NM_153187.1

Homo sapiens solute carrier family 22 member 1 (SLC22A1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
SLC22A1 (6580)
Length:
1808
CDS:
106..1626

Additional Resources:

NCBI RefSeq record:
NM_153187.1
NBCI Gene record:
SLC22A1 (6580)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043210 CGATTTACCTTAAGGTCCAAA pLKO.1 1614 CDS 100% 4.950 6.930 N SLC22A1 n/a
2 TRCN0000043212 CCTGCACTGGTTAAACATCAT pLKO.1 1383 CDS 100% 4.950 3.465 N SLC22A1 n/a
3 TRCN0000043209 GCTACACCCTAATCACAGAAT pLKO.1 764 CDS 100% 4.950 3.465 N SLC22A1 n/a
4 TRCN0000043208 CCTCTTTCAGTCCTGTTTGAA pLKO.1 552 CDS 100% 5.625 3.375 N SLC22A1 n/a
5 TRCN0000043211 CCTGCTGATTTAAAGATGCTT pLKO.1 1045 CDS 100% 3.000 1.800 N SLC22A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06973 pDONR223 100% 91.2% 83.2% None 480G>C;1384_1385ins113;1518_1519ins31 n/a
2 ccsbBroad304_06973 pLX_304 0% 91.2% 83.2% V5 480G>C;1384_1385ins113;1518_1519ins31 n/a
3 TRCN0000473416 AATTTCCCGCCATCCAGTCTCCGG pLX_317 18.5% 91.2% 83.2% V5 480G>C;1384_1385ins113;1518_1519ins31 n/a
4 TRCN0000488994 GTGGTTCAGACGCCCATGGGTATT pLX_317 21.6% 91.2% 83% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV