Transcript: Human NM_153439.1

Homo sapiens outer dense fiber of sperm tails 2 (ODF2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Homo sapiens (human)
Gene:
ODF2 (4957)
Length:
2157
CDS:
87..2048

Additional Resources:

NCBI RefSeq record:
NM_153439.1
NBCI Gene record:
ODF2 (4957)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153439.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140177 GAATGCGGTTGGTTGTCTGAA pLKO.1 554 CDS 100% 4.950 6.930 N ODF2 n/a
2 TRCN0000140822 GACTGCTGAGTATTCCGCATT pLKO.1 1652 CDS 100% 4.050 5.670 N ODF2 n/a
3 TRCN0000280592 GACTGCTGAGTATTCCGCATT pLKO_005 1652 CDS 100% 4.050 5.670 N ODF2 n/a
4 TRCN0000139291 CCGAGACAAAGAGAGCTTGAA pLKO.1 1349 CDS 100% 4.950 3.465 N ODF2 n/a
5 TRCN0000280593 CCGAGACAAAGAGAGCTTGAA pLKO_005 1349 CDS 100% 4.950 3.465 N ODF2 n/a
6 TRCN0000145303 CTTCAGAAGAAACACCTACAA pLKO.1 744 CDS 100% 4.950 3.465 N ODF2 n/a
7 TRCN0000280594 CTTCAGAAGAAACACCTACAA pLKO_005 744 CDS 100% 4.950 3.465 N ODF2 n/a
8 TRCN0000121634 GAAAGACTAATGGAGCAACAA pLKO.1 1011 CDS 100% 4.950 3.465 N ODF2 n/a
9 TRCN0000144392 CAACTATAAGAGTCAGGTGAT pLKO.1 1793 CDS 100% 4.050 2.835 N ODF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153439.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11008 pDONR223 100% 65.3% 63.7% None (many diffs) n/a
2 ccsbBroad304_11008 pLX_304 0% 65.3% 63.7% V5 (many diffs) n/a
3 TRCN0000465232 CTCGCCGGGAATAAGATTTCCTCC pLX_317 14.7% 65.3% 63.7% V5 (many diffs) n/a
Download CSV