Transcript: Mouse NM_172124.2

Mus musculus beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S) (B3gat2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
B3gat2 (280645)
Length:
4367
CDS:
710..1684

Additional Resources:

NCBI RefSeq record:
NM_172124.2
NBCI Gene record:
B3gat2 (280645)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172124.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098766 CGGACAGAGAAGGTCAATCTA pLKO.1 1616 CDS 100% 5.625 7.875 N B3gat2 n/a
2 TRCN0000098768 GCTATGAACGTCCGTTGGTAA pLKO.1 1359 CDS 100% 4.950 6.930 N B3gat2 n/a
3 TRCN0000035656 GCAAAGTTGTTGGCTGGTACA pLKO.1 1386 CDS 100% 4.050 3.240 N B3GAT2 n/a
4 TRCN0000098769 CAATCCGAAAGCTGTATTTAA pLKO.1 1480 CDS 100% 15.000 10.500 N B3gat2 n/a
5 TRCN0000098767 CCAATCCGAAAGCTGTATTTA pLKO.1 1479 CDS 100% 15.000 10.500 N B3gat2 n/a
6 TRCN0000098765 CCTCTCTATTAACATCCTAAA pLKO.1 3413 3UTR 100% 10.800 7.560 N B3gat2 n/a
7 TRCN0000422942 GGATGCAAGAATCTGACTTTC pLKO_005 1521 CDS 100% 10.800 7.560 N B3GAT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172124.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13183 pDONR223 100% 68.6% 69.1% None (many diffs) n/a
2 ccsbBroad304_13183 pLX_304 0% 68.6% 69.1% V5 (many diffs) n/a
3 TRCN0000469765 CCTCCGTGTCCGCAAAACTAATGT pLX_317 64.4% 68.6% 69.1% V5 (many diffs) n/a
Download CSV