Transcript: Human NM_172316.2

Homo sapiens Meis homeobox 2 (MEIS2), transcript variant h, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
MEIS2 (4212)
Length:
3139
CDS:
726..1646

Additional Resources:

NCBI RefSeq record:
NM_172316.2
NBCI Gene record:
MEIS2 (4212)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172316.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274056 CCCACACCCTACTCAATTAAG pLKO_005 1775 3UTR 100% 13.200 18.480 N MEIS2 n/a
2 TRCN0000016046 CCACAAATCTCGCTGACCATA pLKO.1 1081 CDS 100% 4.950 6.930 N MEIS2 n/a
3 TRCN0000016043 CGGCCTTTGTTCCTCCATAAA pLKO.1 2515 3UTR 100% 13.200 10.560 N MEIS2 n/a
4 TRCN0000016044 CCCATGATTGACCAGTCAAAT pLKO.1 1470 CDS 100% 13.200 9.240 N MEIS2 n/a
5 TRCN0000274060 CCCATGATTGACCAGTCAAAT pLKO_005 1470 CDS 100% 13.200 9.240 N MEIS2 n/a
6 TRCN0000274058 GAGCCAAGGAGCAGCATATAG pLKO_005 1499 CDS 100% 13.200 9.240 N MEIS2 n/a
7 TRCN0000274059 ACAAGCAATACAAGTACTAAG pLKO_005 905 CDS 100% 10.800 7.560 N MEIS2 n/a
8 TRCN0000016045 CCACCGATACATTAGCTGTTT pLKO.1 977 CDS 100% 4.950 3.465 N MEIS2 n/a
9 TRCN0000075590 CCCACAATGTTAAATTCTGTA pLKO.1 1905 3UTR 100% 4.950 3.465 N Meis2 n/a
10 TRCN0000301327 CCCACAATGTTAAATTCTGTA pLKO_005 1905 3UTR 100% 4.950 3.465 N Meis2 n/a
11 TRCN0000016047 CCAAGTAAACAACTGGTTTAT pLKO.1 1424 CDS 100% 1.320 0.924 N MEIS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172316.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00999 pDONR223 100% 80.1% 80% None 1_1delAins226;3G>A n/a
2 ccsbBroad304_00999 pLX_304 0% 80.1% 80% V5 1_1delAins226;3G>A n/a
3 TRCN0000470691 ACACACCCAATCGGACACGTGCAG pLX_317 35% 80.1% 80% V5 1_1delAins226;3G>A n/a
4 ccsbBroadEn_00998 pDONR223 100% 63.5% 62.3% None (many diffs) n/a
5 ccsbBroad304_00998 pLX_304 0% 63.5% 62.3% V5 (many diffs) n/a
6 TRCN0000465719 ACTGCGGCTGATCAGATCCCCAGG pLX_317 23% 63.5% 62.3% V5 (many diffs) n/a
Download CSV