Construct: ORF TRCN0000470691
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006420.1_s317c1
- Derived from:
- ccsbBroadEn_00999
- DNA Barcode:
- ACACACCCAATCGGACACGTGCAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MEIS2 (4212)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470691
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4212 | MEIS2 | Meis homeobox 2 | NM_002399.3 | 100% | 100% | |
| 2 | human | 4212 | MEIS2 | Meis homeobox 2 | NM_172315.3 | 98.1% | 98.1% | 995_1015del |
| 3 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_024449929.1 | 98.1% | 98.1% | 995_1015del |
| 4 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_006720525.1 | 96.9% | 96.9% | 1_36del |
| 5 | human | 4212 | MEIS2 | Meis homeobox 2 | NM_170674.5 | 96.7% | 96.7% | 1_39del |
| 6 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_006720524.1 | 95.2% | 95.2% | 1_36del;1031_1051del |
| 7 | human | 4212 | MEIS2 | Meis homeobox 2 | NM_170677.5 | 95% | 95% | 1_39del;1034_1054del |
| 8 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_024449927.1 | 81.7% | 80.6% | (many diffs) |
| 9 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_024449925.1 | 80.5% | 79.4% | (many diffs) |
| 10 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_024449926.1 | 80.5% | 79.4% | (many diffs) |
| 11 | human | 4212 | MEIS2 | Meis homeobox 2 | NM_172316.2 | 80.1% | 80% | 1_1delAins226;3G>A |
| 12 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_017022205.2 | 80.1% | 80% | 1_1delAins226;3G>A |
| 13 | human | 4212 | MEIS2 | Meis homeobox 2 | NM_001220482.2 | 79.5% | 78.4% | (many diffs) |
| 14 | human | 4212 | MEIS2 | Meis homeobox 2 | NM_170676.5 | 79.5% | 78.4% | (many diffs) |
| 15 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_006720523.1 | 78.5% | 77.4% | (many diffs) |
| 16 | human | 4212 | MEIS2 | Meis homeobox 2 | NM_170675.5 | 78.3% | 77.2% | (many diffs) |
| 17 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_006720526.3 | 64.3% | 63.1% | (many diffs) |
| 18 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_024449928.1 | 64.3% | 63.1% | (many diffs) |
| 19 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_006720529.3 | 63.9% | 63.9% | 0_1ins399;596_616del |
| 20 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_006720527.3 | 52% | 50.9% | (many diffs) |
| 21 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_011521591.2 | 52% | 50.9% | (many diffs) |
| 22 | human | 4212 | MEIS2 | Meis homeobox 2 | XR_002957641.1 | 35% | 1_427del;1288_1289ins77;1494_2967del | |
| 23 | human | 4212 | MEIS2 | Meis homeobox 2 | XR_002957640.1 | 34.7% | (many diffs) | |
| 24 | human | 4212 | MEIS2 | Meis homeobox 2 | XR_001751290.2 | 34.2% | (many diffs) | |
| 25 | human | 4212 | MEIS2 | Meis homeobox 2 | NR_051953.2 | 19.1% | 1_1122del;1983_1984ins77;2189_5484del | |
| 26 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001159570.2 | 91.6% | 96.9% | (many diffs) |
| 27 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001136072.2 | 91.3% | 96.7% | (many diffs) |
| 28 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001159569.2 | 90% | 95.2% | (many diffs) |
| 29 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001159567.1 | 89.7% | 95% | (many diffs) |
| 30 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_006498871.3 | 87.1% | 92.2% | (many diffs) |
| 31 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001346047.1 | 85.7% | 90.7% | (many diffs) |
| 32 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316117.1 | 85.7% | 90.7% | (many diffs) |
| 33 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001346045.1 | 78.7% | 83.3% | (many diffs) |
| 34 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316114.1 | 78.7% | 83.3% | (many diffs) |
| 35 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001346044.1 | 77.7% | 82.2% | (many diffs) |
| 36 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316113.1 | 77.7% | 82.2% | (many diffs) |
| 37 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316109.1 | 75.6% | 80% | (many diffs) |
| 38 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001346041.1 | 75.4% | 78.9% | (many diffs) |
| 39 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316112.1 | 75.4% | 78.9% | (many diffs) |
| 40 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001346056.1 | 75.4% | 80% | (many diffs) |
| 41 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_010825.3 | 75.2% | 78.7% | (many diffs) |
| 42 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316108.1 | 74.5% | 78.8% | (many diffs) |
| 43 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001346038.1 | 74.3% | 77.7% | (many diffs) |
| 44 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316111.1 | 74.3% | 77.7% | (many diffs) |
| 45 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001159568.1 | 74.1% | 77.6% | (many diffs) |
| 46 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001346053.1 | 74% | 78.6% | (many diffs) |
| 47 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001346055.1 | 74% | 78.6% | (many diffs) |
| 48 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316107.1 | 72.3% | 75.7% | (many diffs) |
| 49 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316104.1 | 71.3% | 74.6% | (many diffs) |
| 50 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001346036.1 | 65.6% | 68.7% | (many diffs) |
| 51 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_006498865.3 | 65.6% | 68.7% | (many diffs) |
| 52 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_006498864.3 | 65.5% | 68.5% | (many diffs) |
| 53 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316101.1 | 64.1% | 67% | (many diffs) |
| 54 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_011239336.2 | 63.3% | 66.2% | (many diffs) |
| 55 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_011239337.2 | 63.3% | 66.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1209
- ORF length:
- 1143
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga cggagtaggg gttcccgctt ccatgtacgg agaccctcac gcgccgcggc 121 cgatcccccc ggttcaccac ctgaaccacg ggccgccgct ccacgccaca cagcactacg 181 gcgcgcacgc cccgcacccc aatgtcatgc cggccagtat gggatccgct gtcaacgacg 241 ccttgaagcg ggacaaggac gcgatctatg ggcacccgtt gtttcctctg ttagctctgg 301 tctttgagaa gtgcgagctg gcgacctgca ctccccggga acctggagtg gctggcggag 361 acgtctgctc ctccgactcc ttcaacgagg acatcgcggt cttcgccaag caggttcgcg 421 ccgaaaagcc acttttttcc tcaaatccag agctggacaa tttgatgata caagcaatac 481 aagtactaag gtttcatctt ttggagttag aaaaggtcca cgaactgtgc gataacttct 541 gccaccgata cattagctgt ttgaagggga aaatgcccat cgacctcgtc attgatgaaa 601 gagacggcag ctccaagtca gatcatgaag aactttcagg ctcctccaca aatctcgctg 661 accataaccc ttcttcttgg cgagaccacg atgatgcaac ctcaacccac tcagcaggca 721 ccccagggcc ctccagtggg ggccatgctt cccagagcgg agacaacagc agtgagcaag 781 gggatggttt agacaacagt gtagcttcac cTGGTACAGG TGACGATGAT GATCCGGATA 841 AGGACAAAAA ACGCCAGAAG AAAAGAGGCA TTTTCCCCAA AGTAGCAACA AATATCATGA 901 GAGCATGGCT CTTCCAGCAT CTCACACATC CGTACCCTTC CGAAGAGCAG AAGAAACAGT 961 TAGCGCAAGA CACAGGACTT ACAATTCTCC AAGTAAACAA CTGGTTTATT AATGCCAGAA 1021 GAAGAATAGT ACAGCCCATG ATTGACCAGT CAAATCGAGC AGTGAGCCAA GGAGCAGCAT 1081 ATAGTCCAGA GGGTCAGCCC ATGGGGAGCT TTGTGTTGGA TGGTCAGCAA CACATGGGGA 1141 TCCGGCCTGC AGGACCTATG AGTGGAATGG GCATGAATAT GGGCATGGAT GGGCAATGGC 1201 ACTACATGTA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1261 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1321 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAACACAC CCAATCGGAC ACGTGCAGAC 1381 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt