Construct: ORF TRCN0000465719
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014106.1_s317c1
- Derived from:
- ccsbBroadEn_00998
- DNA Barcode:
- ACTGCGGCTGATCAGATCCCCAGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MEIS2 (4212)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465719
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4212 | MEIS2 | Meis homeobox 2 | NM_001220482.2 | 100% | 100% | |
| 2 | human | 4212 | MEIS2 | Meis homeobox 2 | NM_170676.5 | 100% | 100% | |
| 3 | human | 4212 | MEIS2 | Meis homeobox 2 | NM_170675.5 | 98.5% | 98.5% | 1034_1054del |
| 4 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_006720523.1 | 97.5% | 97.6% | (many diffs) |
| 5 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_024449927.1 | 97.2% | 97.2% | 0_1ins39 |
| 6 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_024449925.1 | 95.8% | 95.8% | 0_1ins39;995_1015del |
| 7 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_024449926.1 | 95.8% | 95.8% | 0_1ins39;995_1015del |
| 8 | human | 4212 | MEIS2 | Meis homeobox 2 | NM_170674.5 | 82.2% | 81.1% | (many diffs) |
| 9 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_006720525.1 | 81.3% | 80.3% | (many diffs) |
| 10 | human | 4212 | MEIS2 | Meis homeobox 2 | NM_170677.5 | 81% | 80% | (many diffs) |
| 11 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_006720524.1 | 80.1% | 79.1% | (many diffs) |
| 12 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_006720526.3 | 79.9% | 79.8% | 1_1delAins265;3G>A;770_790del |
| 13 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_024449928.1 | 79.9% | 79.8% | 1_1delAins265;3G>A;770_790del |
| 14 | human | 4212 | MEIS2 | Meis homeobox 2 | NM_002399.3 | 79.5% | 78.4% | (many diffs) |
| 15 | human | 4212 | MEIS2 | Meis homeobox 2 | NM_172315.3 | 78.3% | 77.2% | (many diffs) |
| 16 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_024449929.1 | 78.3% | 77.2% | (many diffs) |
| 17 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_006720527.3 | 67.9% | 67.9% | 0_1ins438;596_616del |
| 18 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_011521591.2 | 67.9% | 67.9% | 0_1ins438;596_616del |
| 19 | human | 4212 | MEIS2 | Meis homeobox 2 | NM_172316.2 | 63.5% | 62.3% | (many diffs) |
| 20 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_017022205.2 | 63.5% | 62.3% | (many diffs) |
| 21 | human | 4212 | MEIS2 | Meis homeobox 2 | XM_006720529.3 | 50.6% | 49.5% | (many diffs) |
| 22 | human | 4212 | MEIS2 | Meis homeobox 2 | XR_002957641.1 | 43.6% | (many diffs) | |
| 23 | human | 4212 | MEIS2 | Meis homeobox 2 | XR_002957640.1 | 43.3% | (many diffs) | |
| 24 | human | 4212 | MEIS2 | Meis homeobox 2 | XR_001751290.2 | 42.8% | (many diffs) | |
| 25 | human | 4212 | MEIS2 | Meis homeobox 2 | NR_051953.2 | 23.9% | (many diffs) | |
| 26 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_010825.3 | 95.3% | 99.5% | (many diffs) |
| 27 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001346041.1 | 94.4% | 98.7% | (many diffs) |
| 28 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316112.1 | 94.4% | 98.7% | (many diffs) |
| 29 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001159568.1 | 93.9% | 98.1% | (many diffs) |
| 30 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001346038.1 | 93% | 97.2% | (many diffs) |
| 31 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316111.1 | 93% | 97.2% | (many diffs) |
| 32 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316107.1 | 90.9% | 94.8% | (many diffs) |
| 33 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316104.1 | 89.6% | 93.5% | (many diffs) |
| 34 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_006498864.3 | 83% | 86.6% | (many diffs) |
| 35 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001346036.1 | 82.2% | 85.9% | (many diffs) |
| 36 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_006498865.3 | 82.2% | 85.9% | (many diffs) |
| 37 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316101.1 | 80.6% | 84% | (many diffs) |
| 38 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_011239336.2 | 79.6% | 83% | (many diffs) |
| 39 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_011239337.2 | 79.6% | 83% | (many diffs) |
| 40 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001136072.2 | 77.9% | 81.1% | (many diffs) |
| 41 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001159570.2 | 77% | 80.3% | (many diffs) |
| 42 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001159567.1 | 76.8% | 80% | (many diffs) |
| 43 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001159569.2 | 75.9% | 79.1% | (many diffs) |
| 44 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_006498871.3 | 74.3% | 77.2% | (many diffs) |
| 45 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001346047.1 | 73.2% | 76.1% | (many diffs) |
| 46 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316117.1 | 73.2% | 76.1% | (many diffs) |
| 47 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001346045.1 | 68.8% | 71.6% | (many diffs) |
| 48 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316114.1 | 68.8% | 71.6% | (many diffs) |
| 49 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001346044.1 | 67.1% | 69.9% | (many diffs) |
| 50 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316113.1 | 67.1% | 69.9% | (many diffs) |
| 51 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316109.1 | 65.9% | 68.4% | (many diffs) |
| 52 | mouse | 17536 | Meis2 | Meis homeobox 2 | XM_017316108.1 | 65% | 67.6% | (many diffs) |
| 53 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001346056.1 | 59.8% | 62.3% | (many diffs) |
| 54 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001346053.1 | 58.9% | 61.4% | (many diffs) |
| 55 | mouse | 17536 | Meis2 | Meis homeobox 2 | NM_001346055.1 | 58.9% | 61.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1476
- ORF length:
- 1410
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gcaaaggtac gatgagctgc cccattacgg cgggatggac ggagtagggg 121 ttcccgcttc catgtacgga gaccctcacg cgccgcggcc gatccccccg gttcaccacc 181 tgaaccacgg gccgccgctc cacgccacac agcactacgg cgcgcacgcc ccgcacccca 241 atgtcatgcc ggccagtatg ggatccgctg tcaacgacgc cttgaagcgg gacaaggacg 301 cgatctatgg gcacccgttg tttcctctgt tagctctggt ctttgagaag tgcgagctgg 361 cgacctgcac tccccgggaa cctggagtgg ctggcggaga cgtctgctcc tccgactcct 421 tcaacgagga catcgcggtc ttcgccaagc aggttcgcgc cgaaaagcca cttttttcct 481 caaatccaga gctggacaat ttgatgatac aagcaataca agtactaagg tttcatcttt 541 tggagttaga aaaggtccac gaactgtgcg ataacttctg ccaccgatac attagctgtt 601 tgaaggggaa aatgcccatc gacctcgtca ttgatgaaag agacggcagc tccaagtcag 661 atcatgaaga actttcaggc tcctccacaa atctcgctga ccataaccct tcttcttggc 721 gagaccacga tgatgcaacc tcaacccact cagcaggcac cccagggccc tccagtgggg 781 gccatgcttc ccagagcgga gacaacagca gtgagcaagg ggatggttta gacaacagtg 841 tagcttcacc tggtacaggt gacgatgatg atccggataa ggacaaaaaa cgccagaaga 901 aaagaggcat tttccccaaa gtagcaacaa atatcatgag agcatggctc ttccagcatc 961 tcacacatcc gtacccttcc gaagagcaga agaaacagtt agcgcaagac acaggactta 1021 caattctcca agtaaacaac tggtttatta atgccagaag aagaatagta cagcccatga 1081 ttgaccagtc aaatcgagca gtgagccaag gagcagcata tagtccagag ggtcagccca 1141 tggggagctt tgtgttGGAT GGTCAGCAAC ACATGGGGAT CCGGCCTGCA GGTTTGCAGA 1201 GCATGCCAGG GGACTACGTT TCTCAGGGTG GTCCTATGGG AATGAGTATG GCACAGCCAA 1261 GTTACACTCC TCCCCAGATG ACCCCACACC CTACTCAATT AAGACATGGA CCCCCAATGC 1321 ATTCATATTT GCCAAGCCAT CCCCACCACC CAGCCATGAT GATGCACGGA GGACCCCCTA 1381 CCCACCCTGG AATGACTATG TCAGCACAGA GCCCCACAAT GTTAAATTCT GTAGATCCCA 1441 ATGTTGGCGG ACAGGTTATG GACATTCATG CCCAATACCC AACTTTCTTG TACAAAGTGG 1501 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1561 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1621 AACTGCGGCT GATCAGATCC CCAGGACGCG TTAAGTCgac aatcaacctc tggattacaa 1681 aatttgtgaa agatt