Transcript: Mouse NM_172400.3

Mus musculus DnaJ heat shock protein family (Hsp40) member C8 (Dnajc8), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Dnajc8 (68598)
Length:
1410
CDS:
28..789

Additional Resources:

NCBI RefSeq record:
NM_172400.3
NBCI Gene record:
Dnajc8 (68598)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172400.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009592 CCACGCCTCTAACTTAATGTT pLKO.1 1029 3UTR 100% 5.625 7.875 N Dnajc8 n/a
2 TRCN0000345089 CCACGCCTCTAACTTAATGTT pLKO_005 1029 3UTR 100% 5.625 7.875 N Dnajc8 n/a
3 TRCN0000009593 ACACACTGTTAAAGAGCGAAA pLKO.1 420 CDS 100% 4.050 3.240 N Dnajc8 n/a
4 TRCN0000022286 GCTTACAAGTTGCTACTGGAT pLKO.1 343 CDS 100% 2.640 2.112 N DNAJC8 n/a
5 TRCN0000342806 GCTTACAAGTTGCTACTGGAT pLKO_005 343 CDS 100% 2.640 2.112 N DNAJC8 n/a
6 TRCN0000009594 GAGTGGACAGTTGGCGAAATT pLKO.1 683 CDS 100% 13.200 9.240 N Dnajc8 n/a
7 TRCN0000009595 ACTGTTCAAACAGGCAGTCTA pLKO.1 495 CDS 100% 4.950 3.465 N Dnajc8 n/a
8 TRCN0000345011 ACTGTTCAAACAGGCAGTCTA pLKO_005 495 CDS 100% 4.950 3.465 N Dnajc8 n/a
9 TRCN0000011805 CCAGAGAGTAGCGATTGCTTT pLKO.1 860 3UTR 100% 4.950 3.465 N Dnajc8 n/a
10 TRCN0000345088 CCAGAGAGTAGCGATTGCTTT pLKO_005 860 3UTR 100% 4.950 3.465 N Dnajc8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172400.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07804 pDONR223 100% 90.9% 99.2% None (many diffs) n/a
2 ccsbBroad304_07804 pLX_304 0% 90.9% 99.2% V5 (many diffs) n/a
3 TRCN0000491969 CTATTCAATCGCCAATAGCAGCTT pLX_317 24.3% 90.9% 99.2% V5 (many diffs) n/a
Download CSV