Transcript: Mouse NM_172513.3

Mus musculus family with sequence similarity 126, member B (Fam126b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Fam126b (213056)
Length:
8695
CDS:
251..1843

Additional Resources:

NCBI RefSeq record:
NM_172513.3
NBCI Gene record:
Fam126b (213056)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172513.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215991 CCGAATTGATTTGGGTTTATT pLKO.1 489 CDS 100% 15.000 21.000 N Fam126b n/a
2 TRCN0000215473 GTTTCAATATGCAGCTAATAT pLKO.1 1812 CDS 100% 15.000 21.000 N Fam126b n/a
3 TRCN0000215607 GCTAATCGATATTCAACTATC pLKO.1 1700 CDS 100% 10.800 15.120 N Fam126b n/a
4 TRCN0000178592 CCGGTTTGAAGTCCTAAGTTT pLKO.1 778 CDS 100% 5.625 7.875 N Fam126b n/a
5 TRCN0000217419 GACACTCAGATTACCAGTTAT pLKO.1 311 CDS 100% 13.200 10.560 N Fam126b n/a
6 TRCN0000340297 ACCAATAGTCTGAGTCTAATC pLKO_005 1568 CDS 100% 10.800 8.640 N Fam126b n/a
7 TRCN0000176905 GCATCATCTTACCAATCTCTT pLKO.1 839 CDS 100% 4.950 3.960 N Fam126b n/a
8 TRCN0000177098 CCCAGGAATGATTGATATTAT pLKO.1 2645 3UTR 100% 15.000 10.500 N Fam126b n/a
9 TRCN0000340375 TTCTCATGCTGTGCTATAATT pLKO_005 798 CDS 100% 15.000 10.500 N Fam126b n/a
10 TRCN0000215549 GAAGGCCAGAAAGTACTTAAA pLKO.1 1136 CDS 100% 13.200 9.240 N Fam126b n/a
11 TRCN0000182451 GCCAGTGCTTCCTCAAGTAAA pLKO.1 1595 CDS 100% 13.200 9.240 N Fam126b n/a
12 TRCN0000215548 GTACTTGATGACATCATTTAC pLKO.1 1025 CDS 100% 13.200 9.240 N Fam126b n/a
13 TRCN0000340374 TAGCTCTGAAGTTCGACTTAA pLKO_005 445 CDS 100% 13.200 9.240 N Fam126b n/a
14 TRCN0000340377 TGATCTCATCAGGGTTGTTTA pLKO_005 715 CDS 100% 13.200 9.240 N Fam126b n/a
15 TRCN0000340300 TGTCGAGGAAATGGTGTATAA pLKO_005 2154 3UTR 100% 13.200 9.240 N Fam126b n/a
16 TRCN0000197527 CCAGTAAACTAGATGTTGAAT pLKO.1 3135 3UTR 100% 5.625 3.938 N Fam126b n/a
17 TRCN0000172874 GCAGCTAATATCCCAGGTGTA pLKO.1 1822 CDS 100% 4.050 2.835 N FAM126B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172513.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09973 pDONR223 100% 91.7% 95.2% None (many diffs) n/a
2 ccsbBroad304_09973 pLX_304 0% 91.7% 95.2% V5 (many diffs) n/a
3 TRCN0000466386 TGGGCATATTGCTTGCTGACCTTC pLX_317 26.7% 91.7% 95.2% V5 (many diffs) n/a
Download CSV