Transcript: Mouse NM_172926.3

Mus musculus sorting nexin 14 (Snx14), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Snx14 (244962)
Length:
3112
CDS:
64..2958

Additional Resources:

NCBI RefSeq record:
NM_172926.3
NBCI Gene record:
Snx14 (244962)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172926.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105777 CCAGAGCTAAATAAGGTACAA pLKO.1 2905 CDS 100% 4.950 6.930 N Snx14 n/a
2 TRCN0000349192 CCAGAGCTAAATAAGGTACAA pLKO_005 2905 CDS 100% 4.950 6.930 N Snx14 n/a
3 TRCN0000105775 CCCTTCATTGTCGAAGAGATT pLKO.1 1381 CDS 100% 4.950 6.930 N Snx14 n/a
4 TRCN0000316754 CCCTTCATTGTCGAAGAGATT pLKO_005 1381 CDS 100% 4.950 6.930 N Snx14 n/a
5 TRCN0000379940 GTGGATATTCCATCTATTATA pLKO_005 694 CDS 100% 15.000 10.500 N SNX14 n/a
6 TRCN0000105776 GCAGCAATGAAACATATAGAA pLKO.1 733 CDS 100% 5.625 3.938 N Snx14 n/a
7 TRCN0000316751 GCAGCAATGAAACATATAGAA pLKO_005 733 CDS 100% 5.625 3.938 N Snx14 n/a
8 TRCN0000105779 CGTATTCAAGAGTACGACAAT pLKO.1 1653 CDS 100% 4.950 3.465 N Snx14 n/a
9 TRCN0000316685 CGTATTCAAGAGTACGACAAT pLKO_005 1653 CDS 100% 4.950 3.465 N Snx14 n/a
10 TRCN0000105778 CGGAGTCTATGATTACCTGAT pLKO.1 2481 CDS 100% 4.050 2.835 N Snx14 n/a
11 TRCN0000316753 CGGAGTCTATGATTACCTGAT pLKO_005 2481 CDS 100% 4.050 2.835 N Snx14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172926.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08720 pDONR223 100% 86.7% 93.6% None (many diffs) n/a
2 ccsbBroad304_08720 pLX_304 0% 86.7% 93.6% V5 (many diffs) n/a
3 TRCN0000465690 TCGTGTACACTAATTCAACAAATA pLX_317 10.4% 86.7% 93.6% V5 (many diffs) n/a
4 ccsbBroadEn_08719 pDONR223 100% 83.4% 90.1% None (many diffs) n/a
5 ccsbBroad304_08719 pLX_304 0% 83.4% 90.1% V5 (many diffs) n/a
6 TRCN0000468783 CCGAGACGTTTCCTGGAGCGCTGC pLX_317 .5% 83.4% 90.1% V5 (many diffs) n/a
Download CSV