Transcript: Human NM_173089.1

Homo sapiens calpain 3 (CAPN3), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
CAPN3 (825)
Length:
1291
CDS:
259..729

Additional Resources:

NCBI RefSeq record:
NM_173089.1
NBCI Gene record:
CAPN3 (825)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173089.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003496 CCACCTCAACAACCAGCTCTA pLKO.1 531 CDS 100% 4.050 2.835 N CAPN3 n/a
2 TRCN0000003495 GCTCCTGCTTACCTTGCTCTA pLKO.1 1020 3UTR 100% 4.050 2.430 N CAPN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173089.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00216 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00216 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470316 GCGTAGCCTTGGAGAACGACCAAC pLX_317 68.4% 100% 100% V5 n/a
4 ccsbBroadEn_00215 pDONR223 100% 50.4% 50.4% None 0_1ins459 n/a
5 ccsbBroad304_00215 pLX_304 0% 50.4% 50.4% V5 0_1ins459 n/a
6 TRCN0000474090 TACAAGAACCAATTATGGAGAGAC pLX_317 57.3% 50.4% 50.4% V5 0_1ins459 n/a
Download CSV