Transcript: Human NM_173351.1

Homo sapiens olfactory receptor family 6 subfamily B member 3 (OR6B3), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
OR6B3 (150681)
Length:
996
CDS:
1..996

Additional Resources:

NCBI RefSeq record:
NM_173351.1
NBCI Gene record:
OR6B3 (150681)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061524 CATGCTGTCATATGCGCACAT pLKO.1 642 CDS 100% 0.000 0.000 N OR6B3 n/a
2 TRCN0000360238 CTGGCCACCATGCTGTCATAT pLKO_005 634 CDS 100% 13.200 7.920 N OR6B3 n/a
3 TRCN0000359972 ACCACTTCTTCTGTGACATTT pLKO_005 524 CDS 100% 13.200 6.600 Y OR6B2 n/a
4 TRCN0000360028 CCGTGGTCACCGTCTTCTATA pLKO_005 737 CDS 100% 13.200 6.600 Y OR6B2 n/a
5 TRCN0000359990 CACTGCAGAGCTGGTGGATTT pLKO_005 579 CDS 100% 10.800 5.400 Y OR6B2 n/a
6 TRCN0000360031 CAGCAGAAACGCATCTCTTTC pLKO_005 262 CDS 100% 10.800 5.400 Y OR6B2 n/a
7 TRCN0000360236 CCACTTCTTCTGTGACATTTC pLKO_005 525 CDS 100% 10.800 5.400 Y OR6B3 n/a
8 TRCN0000360030 CCTTCATCATCCTGGTGTTTC pLKO_005 608 CDS 100% 10.800 5.400 Y OR6B2 n/a
9 TRCN0000367942 CGTGGTCACCGTCTTCTATAC pLKO_005 738 CDS 100% 10.800 5.400 Y OR6B3 n/a
10 TRCN0000360237 TTTCTGAGCTCCATGTCTTTC pLKO_005 184 CDS 100% 10.800 5.400 Y OR6B3 n/a
11 TRCN0000061526 GCAGAGCTGGTGGATTTCATT pLKO.1 583 CDS 100% 5.625 2.813 Y OR6B3 n/a
12 TRCN0000061525 CCAGCAGAAACGCATCTCTTT pLKO.1 261 CDS 100% 4.950 2.475 Y OR6B3 n/a
13 TRCN0000187936 GAACCACTTCTTCTGTGACAT pLKO.1 522 CDS 100% 4.950 2.475 Y Olfr1416 n/a
14 TRCN0000061523 GCCTTCATCATCCTGGTGTTT pLKO.1 607 CDS 100% 4.950 2.475 Y OR6B3 n/a
15 TRCN0000188742 GCCTTCATCATCCTGGTGTTT pLKO.1 607 CDS 100% 4.950 2.475 Y OR6B2 n/a
16 TRCN0000061527 TCTTCTATACAGCCTTGCTTT pLKO.1 749 CDS 100% 4.950 2.475 Y OR6B3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489047 CCACGAGTGGGCTGCTCTATGGTC pLX_317 35.2% 90.9% 88.5% V5 (many diffs) n/a
2 TRCN0000488321 ACCGAGTAACGGCCCCCTTCCCAA pLX_317 33.5% 90.9% 89.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_10098 pDONR223 100% 90.3% 89.1% None (many diffs) n/a
4 ccsbBroad304_10098 pLX_304 0% 90.3% 89.1% V5 (many diffs) n/a
5 TRCN0000480413 CGCGACATGGGCCGTTCCCAATAT pLX_317 38.6% 90.3% 89.1% V5 (many diffs) n/a
Download CSV