Transcript: Mouse NM_173379.2

Mus musculus prolyl 3-hydroxylase 2 (P3h2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
P3h2 (210530)
Length:
2248
CDS:
102..2213

Additional Resources:

NCBI RefSeq record:
NM_173379.2
NBCI Gene record:
P3h2 (210530)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173379.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178649 CGTCATAAACTTGAAGCTGAA pLKO.1 1206 CDS 100% 4.050 3.240 N P3h2 n/a
2 TRCN0000181568 GCAGATCACTATATGCAGGTT pLKO.1 906 CDS 100% 2.640 2.112 N P3h2 n/a
3 TRCN0000200355 GAGTCCCTTCAGGAGTGAATA pLKO.1 1315 CDS 100% 13.200 9.240 N P3h2 n/a
4 TRCN0000181378 CGGGAGGATTTAACAGCATTT pLKO.1 1179 CDS 100% 10.800 7.560 N P3h2 n/a
5 TRCN0000197936 GCACTCAAATTTGGTTATGAA pLKO.1 1626 CDS 100% 5.625 3.938 N P3h2 n/a
6 TRCN0000098494 CTGTTGCTGCTACTGCTGCTA pLKO.1 129 CDS 100% 2.640 1.320 Y Krtap1-5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173379.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14190 pDONR223 100% 64.1% 68.4% None (many diffs) n/a
2 ccsbBroad304_14190 pLX_304 0% 64.1% 68.4% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000465861 ACCTATGGCCATGGACCGGCTGAA pLX_317 21.5% 64.1% 68.4% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV