Transcript: Human NM_173676.2

Homo sapiens patatin like phospholipase domain containing 1 (PNPLA1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
PNPLA1 (285848)
Length:
2367
CDS:
175..1488

Additional Resources:

NCBI RefSeq record:
NM_173676.2
NBCI Gene record:
PNPLA1 (285848)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173676.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078207 CCGTCAGCAAGCCTTATGTAA pLKO.1 1337 CDS 100% 5.625 7.875 N PNPLA1 n/a
2 TRCN0000078205 CGATTACTACTACCGAGGGTA pLKO.1 612 CDS 100% 2.640 3.696 N PNPLA1 n/a
3 TRCN0000078203 GCTCACAATAAGTAGGTATTA pLKO.1 1796 3UTR 100% 13.200 9.240 N PNPLA1 n/a
4 TRCN0000078206 TGAAGACTCAAACTGGGTGAA pLKO.1 1371 CDS 100% 4.050 2.835 N PNPLA1 n/a
5 TRCN0000078204 CCTCTGGTTCATGTGAAGGAA pLKO.1 1315 CDS 100% 3.000 2.100 N PNPLA1 n/a
6 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 1954 3UTR 100% 13.200 6.600 Y IQCC n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1887 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173676.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09986 pDONR223 100% 99.9% 99.7% None 983C>A n/a
2 ccsbBroad304_09986 pLX_304 0% 99.9% 99.7% V5 983C>A n/a
3 TRCN0000465523 GTACGGACATCCGCCAAAATCTAC pLX_317 19.7% 99.9% 99.7% V5 983C>A n/a
4 ccsbBroadEn_09987 pDONR223 100% 97.7% 97.3% None (many diffs) n/a
5 ccsbBroad304_09987 pLX_304 0% 97.7% 97.3% V5 (many diffs) n/a
6 TRCN0000481325 TGCCGCAGGAAACGATTGATGACG pLX_317 29.7% 97.7% 97.3% V5 (many diffs) n/a
Download CSV