Transcript: Mouse NM_173733.3

Mus musculus sulfite oxidase (Suox), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Suox (211389)
Length:
2349
CDS:
79..1719

Additional Resources:

NCBI RefSeq record:
NM_173733.3
NBCI Gene record:
Suox (211389)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173733.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348714 CCTTATGCTGATGATCCTATT pLKO_005 604 CDS 100% 10.800 8.640 N Suox n/a
2 TRCN0000348715 CATCCAGCCCTGAGGATTAAT pLKO_005 628 CDS 100% 15.000 10.500 N Suox n/a
3 TRCN0000348716 GAGTTACTGGCCGAGTATAAG pLKO_005 529 CDS 100% 13.200 9.240 N Suox n/a
4 TRCN0000376935 TGGATGATTTGCATAAGTTTC pLKO_005 821 CDS 100% 10.800 7.560 N Suox n/a
5 TRCN0000076667 CTCCTGGCTTATGAAATGAAT pLKO.1 1120 CDS 100% 5.625 3.938 N Suox n/a
6 TRCN0000076663 GCACCATTTGTACCCAAAGAA pLKO.1 1732 3UTR 100% 5.625 3.938 N Suox n/a
7 TRCN0000351948 GCACCATTTGTACCCAAAGAA pLKO_005 1732 3UTR 100% 5.625 3.938 N Suox n/a
8 TRCN0000076665 GCTGTAGATGACAGTTACAAT pLKO.1 1609 CDS 100% 5.625 3.938 N Suox n/a
9 TRCN0000367663 GCTGTAGATGACAGTTACAAT pLKO_005 1609 CDS 100% 5.625 3.938 N Suox n/a
10 TRCN0000076666 CCTCCTGAACTGCTAACTGAA pLKO.1 676 CDS 100% 4.950 3.465 N Suox n/a
11 TRCN0000076664 GCTCCATCAATTCAGGAACTA pLKO.1 1330 CDS 100% 4.950 3.465 N Suox n/a
12 TRCN0000376936 TGTGGACTGGGACACGGTAAA pLKO_005 1299 CDS 100% 10.800 6.480 N Suox n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173733.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07017 pDONR223 100% 85.4% 85.5% None (many diffs) n/a
2 ccsbBroad304_07017 pLX_304 0% 85.4% 85.5% V5 (many diffs) n/a
3 TRCN0000477856 TCTCAGTCTCCACTCGTCTTGAGA pLX_317 15.3% 85.4% 85.5% V5 (many diffs) n/a
Download CSV