Transcript: Mouse NM_173749.4

Mus musculus peptidase domain containing associated with muscle regeneration 1 (Pamr1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pamr1 (210622)
Length:
2855
CDS:
172..2334

Additional Resources:

NCBI RefSeq record:
NM_173749.4
NBCI Gene record:
Pamr1 (210622)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173749.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056042 CCAGGTTGTACCATCTTTGAA pLKO.1 418 CDS 100% 5.625 7.875 N PAMR1 n/a
2 TRCN0000031449 GCATCCAGAATTTACGGGTTT pLKO.1 1781 CDS 100% 4.050 3.240 N Pamr1 n/a
3 TRCN0000031453 GCCCTGGCTTTAAGAATGATA pLKO.1 1997 CDS 100% 5.625 3.938 N Pamr1 n/a
4 TRCN0000031450 CCAAGAGAGTACACGGTCATT pLKO.1 238 CDS 100% 4.950 3.465 N Pamr1 n/a
5 TRCN0000031451 GCTGGAGCTATGACAAGACAT pLKO.1 2240 CDS 100% 4.950 3.465 N Pamr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173749.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02880 pDONR223 100% 84.2% 88.1% None (many diffs) n/a
2 ccsbBroad304_02880 pLX_304 0% 84.2% 88.1% V5 (many diffs) n/a
3 TRCN0000477550 GGCTCTTTACCACCTTGGTCTCTG pLX_317 17.5% 84.2% 88.1% V5 (many diffs) n/a
Download CSV