Transcript: Human NM_173833.6

Homo sapiens scavenger receptor class A member 5 (SCARA5), mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
SCARA5 (286133)
Length:
3971
CDS:
433..1920

Additional Resources:

NCBI RefSeq record:
NM_173833.6
NBCI Gene record:
SCARA5 (286133)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173833.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157348 CTTCCTGATTCTTGTGGGCAT pLKO.1 639 CDS 100% 2.160 3.024 N SCARA5 n/a
2 TRCN0000156363 CCTGATTCTTGTGGGCATCTT pLKO.1 642 CDS 100% 4.950 3.960 N SCARA5 n/a
3 TRCN0000157012 GAGGATGGTCCATGTCACAAA pLKO.1 538 CDS 100% 4.950 3.960 N SCARA5 n/a
4 TRCN0000157713 CTGCTGGTCTTCCTGATTCTT pLKO.1 631 CDS 100% 5.625 3.938 N SCARA5 n/a
5 TRCN0000156447 CAATGTGAACCGGCTGAATGA pLKO.1 720 CDS 100% 4.950 3.465 N SCARA5 n/a
6 TRCN0000153249 GCATCTTCATCTTAGCAGTGT pLKO.1 656 CDS 100% 2.640 1.848 N SCARA5 n/a
7 TRCN0000158172 CCATCTGTGAGGATTCCTTTG pLKO.1 485 CDS 100% 6.000 3.600 N SCARA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173833.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13563 pDONR223 100% 79.5% 78% None (many diffs) n/a
2 ccsbBroad304_13563 pLX_304 0% 79.5% 78% V5 (many diffs) n/a
3 TRCN0000476470 GCATGGGTTGGCCGAGGACACCAC pLX_317 25.4% 79.5% 78% V5 (many diffs) n/a
Download CSV