Transcript: Mouse NM_173866.3

Mus musculus glutamic pyruvate transaminase (alanine aminotransferase) 2 (Gpt2), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Gpt2 (108682)
Length:
3596
CDS:
96..1664

Additional Resources:

NCBI RefSeq record:
NM_173866.3
NBCI Gene record:
Gpt2 (108682)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173866.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281767 ATTCTCCCTCCGGTGGATAAA pLKO_005 1581 CDS 100% 13.200 18.480 N Gpt2 n/a
2 TRCN0000271696 CACCTACCCAAACCTACTAAA pLKO_005 443 CDS 100% 13.200 18.480 N Gpt2 n/a
3 TRCN0000119732 GCTAGGCATATAATCCAGATA pLKO.1 3016 3UTR 100% 4.950 6.930 N Gpt2 n/a
4 TRCN0000119733 CGGTATTTCTACAATCCTGAA pLKO.1 659 CDS 100% 4.050 5.670 N Gpt2 n/a
5 TRCN0000271697 CGGTGCAGGTCAACTACTATC pLKO_005 775 CDS 100% 10.800 8.640 N Gpt2 n/a
6 TRCN0000271739 GGAGTAGAGGGTTAGTATTTA pLKO_005 3134 3UTR 100% 15.000 10.500 N Gpt2 n/a
7 TRCN0000119734 CCCTAAAGTTCTCTGCATTAT pLKO.1 872 CDS 100% 13.200 9.240 N Gpt2 n/a
8 TRCN0000271695 TGCAGATTCCACTCGTTTAAG pLKO_005 1023 CDS 100% 13.200 9.240 N Gpt2 n/a
9 TRCN0000119736 CAGACAACATTTACCTGACTA pLKO.1 625 CDS 100% 4.950 3.465 N Gpt2 n/a
10 TRCN0000119735 GCTCCACAAGGTGAAAGACTT pLKO.1 1613 CDS 100% 4.950 3.465 N Gpt2 n/a
11 TRCN0000035028 GACAACGTGTACTCTCCAGAT pLKO.1 1002 CDS 100% 4.050 3.240 N GPT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173866.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04417 pDONR223 100% 88.4% 92.9% None (many diffs) n/a
2 ccsbBroad304_04417 pLX_304 0% 88.4% 92.9% V5 (many diffs) n/a
3 TRCN0000492245 TGCCCCCTTGAGTGATGTTAGTGA pLX_317 27.4% 88.4% 92.9% V5 (many diffs) n/a
Download CSV