Transcript: Mouse NM_175642.4

Mus musculus adhesion G protein-coupled receptor B3 (Adgrb3), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Mus musculus (mouse)
Gene:
Adgrb3 (210933)
Length:
5522
CDS:
262..4830

Additional Resources:

NCBI RefSeq record:
NM_175642.4
NBCI Gene record:
Adgrb3 (210933)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175642.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425534 GAAATTACACTGTCGTCAATT pLKO_005 2594 CDS 100% 13.200 18.480 N Adgrb3 n/a
2 TRCN0000356780 CCGATGCATCCCATACGAAAT pLKO_005 2792 CDS 100% 10.800 15.120 N ADGRB3 n/a
3 TRCN0000439653 CCGATGCATCCCATACGAAAT pLKO_005 2792 CDS 100% 10.800 15.120 N Adgrb3 n/a
4 TRCN0000112161 CGCTCCATATTGTTTCAGATA pLKO.1 3631 CDS 100% 4.950 6.930 N Adgrb3 n/a
5 TRCN0000112164 CTTATATCAATGGTGTGGAAA pLKO.1 1816 CDS 100% 4.950 6.930 N Adgrb3 n/a
6 TRCN0000112163 CGCAGCACTATGGAGGTATAT pLKO.1 2958 CDS 100% 13.200 10.560 N Adgrb3 n/a
7 TRCN0000112162 CCTCGATCTGTCCATGAGAAA pLKO.1 1060 CDS 100% 4.950 3.960 N Adgrb3 n/a
8 TRCN0000427648 ACCCAGGCTCAATAGAGTTAA pLKO_005 2264 CDS 100% 13.200 9.240 N Adgrb3 n/a
9 TRCN0000112160 GCCGGGTATTTCCAACTGATT pLKO.1 653 CDS 100% 4.950 3.465 N Adgrb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175642.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489777 TGACATACCTCCTTCTTAAACTTC pLX_317 8% 92.3% 98.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489506 GAAACAGACTACTTCGTCAAGTGC pLX_317 8.8% 92.3% 98.3% V5 (many diffs) n/a
Download CSV