Transcript: Human NM_175738.5

Homo sapiens RAB37, member RAS oncogene family (RAB37), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
RAB37 (326624)
Length:
3031
CDS:
457..1107

Additional Resources:

NCBI RefSeq record:
NM_175738.5
NBCI Gene record:
RAB37 (326624)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_175738.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380389 AGCGTCACCCATGCTTATTAC pLKO_005 715 CDS 100% 13.200 18.480 N RAB37 n/a
2 TRCN0000381713 GGGCATCGGATTCACGAACAA pLKO_005 624 CDS 100% 4.950 6.930 N RAB37 n/a
3 TRCN0000047904 GCAGCGAAAGAGTGATCCGTT pLKO.1 878 CDS 100% 2.640 3.696 N RAB37 n/a
4 TRCN0000047907 CCGAAGCGTCACCCATGCTTA pLKO.1 711 CDS 100% 1.650 2.310 N RAB37 n/a
5 TRCN0000380700 CATCGCCAAGGAACTGAAATA pLKO_005 993 CDS 100% 13.200 9.240 N RAB37 n/a
6 TRCN0000381942 GCTAGGCAACAAGGCGGATAT pLKO_005 855 CDS 100% 10.800 7.560 N RAB37 n/a
7 TRCN0000379684 GCTTCCAGATCCGAGACTATG pLKO_005 1043 CDS 100% 10.800 7.560 N Rab37 n/a
8 TRCN0000380200 CGCTCTCCAGGAGCTTATCTT pLKO_005 1573 3UTR 100% 5.625 3.938 N RAB37 n/a
9 TRCN0000047906 AGCTTCCAGATCCGAGACTAT pLKO.1 1042 CDS 100% 4.950 3.465 N RAB37 n/a
10 TRCN0000047905 CTATGTAGAGTCCCAGAAGAA pLKO.1 1059 CDS 100% 4.950 3.465 N RAB37 n/a
11 TRCN0000047903 CAACAAATCTTCTTTCGACAA pLKO.1 774 CDS 100% 4.050 2.835 N RAB37 n/a
12 TRCN0000380717 TGTATGACATCACCAACAAAT pLKO_005 761 CDS 100% 13.200 7.920 N RAB37 n/a
13 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 2174 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
14 TRCN0000165833 GCTCACTACAACCTCCACTTT pLKO.1 1989 3UTR 100% 4.950 2.475 Y LINC00346 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175738.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05423 pDONR223 100% 86.3% 79.6% None (many diffs) n/a
2 ccsbBroad304_05423 pLX_304 0% 86.3% 79.6% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000471971 ACTCCGCCGCGTCAATCGCGAACT pLX_317 71.7% 86.3% 79.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV