Transcript: Human NM_176876.3

Homo sapiens purinergic receptor P2Y12 (P2RY12), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
P2RY12 (64805)
Length:
2244
CDS:
242..1270

Additional Resources:

NCBI RefSeq record:
NM_176876.3
NBCI Gene record:
P2RY12 (64805)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_176876.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357959 CAAGTTACCTCCGTCATATTT pLKO_005 533 CDS 100% 15.000 21.000 N P2RY12 n/a
2 TRCN0000009476 CCGGAGTAAATCAAACTTTAT pLKO.1 400 CDS 100% 13.200 18.480 N P2RY12 n/a
3 TRCN0000009479 CGGTCTAGTCTGGCATGAAAT pLKO.1 787 CDS 100% 13.200 18.480 N P2RY12 n/a
4 TRCN0000358027 TCCGGAGTAAATCAAACTTTA pLKO_005 399 CDS 100% 13.200 18.480 N P2RY12 n/a
5 TRCN0000358026 TTGTGTTCAGAACTCGTTAAA pLKO_005 1302 3UTR 100% 13.200 9.240 N P2RY12 n/a
6 TRCN0000009477 GCCTAACATGATTCTGACCAA pLKO.1 712 CDS 100% 2.640 1.848 N P2RY12 n/a
7 TRCN0000009478 CCCAAATGAAGAGACTCCAAT pLKO.1 1246 CDS 100% 4.950 2.970 N P2RY12 n/a
8 TRCN0000009475 CTTTGTGTTCAGAACTCGTTA pLKO.1 1300 3UTR 100% 4.950 2.970 N P2RY12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176876.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491982 AGATGAAATCGAAGTGTCCGTAAC pLX_317 41.1% 99.9% 100% V5 (not translated due to prior stop codon) 36T>G n/a
2 ccsbBroadEn_08873 pDONR223 100% 99.8% 100% None 18C>T;36T>G n/a
3 ccsbBroad304_08873 pLX_304 0% 99.8% 100% V5 18C>T;36T>G n/a
4 TRCN0000470996 GACGGTAAGCCAATCCCTTTATGG pLX_317 43.9% 99.8% 100% V5 18C>T;36T>G n/a
5 TRCN0000487732 GTACTTCCTAGACCAAGAACGTAT pLX_317 24.2% 99.7% 99.7% V5 18C>T;36T>G;1026_1027insG n/a
Download CSV