Transcript: Mouse NM_177243.4

Mus musculus solute carrier family 26, member 9 (Slc26a9), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Slc26a9 (320718)
Length:
3640
CDS:
111..2483

Additional Resources:

NCBI RefSeq record:
NM_177243.4
NBCI Gene record:
Slc26a9 (320718)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177243.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009920 CAGGAAATTGCGGGAGTTAAG pLKO.1 1680 CDS 100% 10.800 15.120 N Slc26a9 n/a
2 TRCN0000009918 CAACGCTCGGTACATGCACAA pLKO.1 926 CDS 100% 4.050 5.670 N Slc26a9 n/a
3 TRCN0000296821 TCTTTACCTTCATTGACATTT pLKO_005 823 CDS 100% 13.200 9.240 N SLC26A9 n/a
4 TRCN0000009919 GCTATGATGTGGATTCTAACC pLKO.1 1189 CDS 100% 4.050 2.835 N Slc26a9 n/a
5 TRCN0000009921 AGTGGAGTCAGCTTTGTGGAT pLKO.1 2118 CDS 100% 2.640 1.848 N Slc26a9 n/a
6 TRCN0000009917 CTGACCATTCCCTCCTATACA pLKO.1 786 CDS 100% 5.625 3.375 N Slc26a9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177243.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09411 pDONR223 100% 86.7% 89.6% None (many diffs) n/a
2 ccsbBroad304_09411 pLX_304 0% 86.7% 89.6% V5 (many diffs) n/a
3 TRCN0000476089 GGCGACATTGCGCTGAAATTTATA pLX_317 13.2% 86.7% 89.6% V5 (many diffs) n/a
Download CSV