Transcript: Mouse NM_177732.4

Mus musculus solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1 (Slc35d1), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Slc35d1 (242585)
Length:
2893
CDS:
19..939

Additional Resources:

NCBI RefSeq record:
NM_177732.4
NBCI Gene record:
Slc35d1 (242585)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177732.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314028 ATCGGCCTAAATATCAGTATT pLKO_005 814 CDS 100% 13.200 18.480 N Slc35d1 n/a
2 TRCN0000079506 CGACAGAAATGTACCTCGAAA pLKO.1 321 CDS 100% 4.950 6.930 N Slc35d1 n/a
3 TRCN0000314078 CAATGTTCCTTTGCAATTATA pLKO_005 985 3UTR 100% 15.000 12.000 N Slc35d1 n/a
4 TRCN0000233167 GGTCTTTGGTGGAGATTATAT pLKO_005 774 CDS 100% 15.000 12.000 N SLC35D1 n/a
5 TRCN0000233165 CACCCTGGCCATTGCGTATTT pLKO_005 708 CDS 100% 13.200 10.560 N SLC35D1 n/a
6 TRCN0000350053 CACCCTGGCCATTGCGTATTT pLKO_005 708 CDS 100% 13.200 10.560 N Slc35d1 n/a
7 TRCN0000314076 TTCCACTACCTCTACTATATT pLKO_005 347 CDS 100% 15.000 10.500 N Slc35d1 n/a
8 TRCN0000079505 GCCTTTGATCTGGAAGGATAT pLKO.1 562 CDS 100% 10.800 7.560 N Slc35d1 n/a
9 TRCN0000317806 GCCTTTGATCTGGAAGGATAT pLKO_005 562 CDS 100% 10.800 7.560 N Slc35d1 n/a
10 TRCN0000079504 CCATGTTTACAGTTCTGAGAA pLKO.1 416 CDS 100% 4.950 3.465 N Slc35d1 n/a
11 TRCN0000079507 CTATTACAATGCACTGTTCAT pLKO.1 678 CDS 100% 4.950 3.465 N Slc35d1 n/a
12 TRCN0000038548 GCTCTATTACAATGCACTGTT pLKO.1 675 CDS 100% 4.950 3.465 N SLC35D1 n/a
13 TRCN0000079503 GCTGGAATACAGAGATCCATT pLKO.1 1796 3UTR 100% 4.950 3.465 N Slc35d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177732.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02726 pDONR223 100% 80% 83.6% None (many diffs) n/a
2 ccsbBroad304_02726 pLX_304 0% 80% 83.6% V5 (many diffs) n/a
3 TRCN0000475667 GCGGTCCAATCCCCATATAGTTTT pLX_317 9.2% 80% 83.6% V5 (many diffs) n/a
Download CSV