Transcript: Mouse NM_177791.3

Mus musculus potassium channel tetramerisation domain containing 19 (Kctd19), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Kctd19 (279499)
Length:
3076
CDS:
47..2899

Additional Resources:

NCBI RefSeq record:
NM_177791.3
NBCI Gene record:
Kctd19 (279499)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177791.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250667 GTTTAGGCATGTGCACTATTA pLKO_005 232 CDS 100% 13.200 10.560 N Kctd19 n/a
2 TRCN0000250669 GAAGAAGTGCACCACTATAAA pLKO_005 1948 CDS 100% 15.000 10.500 N Kctd19 n/a
3 TRCN0000258069 GACAGCTGAGGTCACGATATA pLKO_005 1273 CDS 100% 13.200 9.240 N Kctd19 n/a
4 TRCN0000250668 ATGCTAACGGGACCGACAATC pLKO_005 2367 CDS 100% 10.800 7.560 N Kctd19 n/a
5 TRCN0000201490 CCTTGCTTCAGACCCTAGATA pLKO.1 336 CDS 100% 5.625 3.938 N Kctd19 n/a
6 TRCN0000190709 GCCAATGAAAGTGGCTCTGAA pLKO.1 1198 CDS 100% 4.950 3.465 N Kctd19 n/a
7 TRCN0000190803 GCTTACAGAAGCTGTACGGTT pLKO.1 784 CDS 100% 2.640 1.848 N Kctd19 n/a
8 TRCN0000258082 TTCAGTCCTGGGCAAGTATTT pLKO_005 2866 CDS 100% 13.200 7.920 N Kctd19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177791.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04982 pDONR223 100% 84.4% 86.6% None (many diffs) n/a
2 ccsbBroad304_04982 pLX_304 0% 84.4% 86.6% V5 (many diffs) n/a
3 TRCN0000465759 CGCCTGCGCACATCACTACTGGCC pLX_317 13.1% 84.4% 86.6% V5 (many diffs) n/a
Download CSV