Transcript: Human NM_177965.4

Homo sapiens chromosome 8 open reading frame 37 (C8orf37), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
C8orf37 (157657)
Length:
3340
CDS:
13..636

Additional Resources:

NCBI RefSeq record:
NM_177965.4
NBCI Gene record:
C8orf37 (157657)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_177965.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139392 GAAGAGCCCAACTTGGACAAA pLKO.1 226 CDS 100% 4.950 6.930 N C8orf37 n/a
2 TRCN0000139915 GCCAGGGCAAAGAGATCATTT pLKO.1 1021 3UTR 100% 13.200 10.560 N C8orf37 n/a
3 TRCN0000145120 GAAGATGATCTTGACAGTCTT pLKO.1 190 CDS 100% 4.950 3.960 N C8orf37 n/a
4 TRCN0000139935 GCCCTACAATAGCAGCACATT pLKO.1 1595 3UTR 100% 4.950 3.960 N C8orf37 n/a
5 TRCN0000140950 CCAGTGTAGCTGGAGAACTAT pLKO.1 555 CDS 100% 5.625 3.938 N C8orf37 n/a
6 TRCN0000143688 GATGAAGTCGAGTCCAAGTTT pLKO.1 40 CDS 100% 5.625 3.938 N C8orf37 n/a
7 TRCN0000144812 GCTCAGATCAACAGAAACATT pLKO.1 162 CDS 100% 5.625 3.938 N C8orf37 n/a
8 TRCN0000139832 CTTCCATTGAAGGCCTTGGTA pLKO.1 296 CDS 100% 3.000 2.100 N C8orf37 n/a
9 TRCN0000142931 CTTCAGACAGATCATCAGCTT pLKO.1 592 CDS 100% 2.640 1.848 N C8orf37 n/a
10 TRCN0000215776 CAGATCAACAGAAACATTTAA pLKO.1 165 CDS 100% 15.000 9.000 N 2610301B20Rik n/a
11 TRCN0000122448 GAAGAAAGGAACACGGGCATA pLKO.1 528 CDS 100% 4.050 2.430 N C8orf37 n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1984 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2681 3UTR 100% 4.950 2.475 Y n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1985 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177965.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14411 pDONR223 100% 99.8% 36.2% None 217delG n/a
2 ccsbBroad304_14411 pLX_304 0% 99.8% 36.2% V5 (not translated due to prior stop codon) 217delG n/a
3 TRCN0000473378 GTAATTTCGTTCCCAATATCCCTA pLX_317 67.9% 99.8% 36.2% V5 (not translated due to prior stop codon) 217delG n/a
Download CSV