Transcript: Mouse NM_178594.3

Mus musculus V-set domain containing T cell activation inhibitor 1 (Vtcn1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Vtcn1 (242122)
Length:
2622
CDS:
101..952

Additional Resources:

NCBI RefSeq record:
NM_178594.3
NBCI Gene record:
Vtcn1 (242122)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178594.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249191 ACCAAACTAGAGTATACTAAG pLKO_005 1178 3UTR 100% 10.800 15.120 N Vtcn1 n/a
2 TRCN0000249192 GAGATAAATGTGGACTATAAT pLKO_005 560 CDS 100% 15.000 10.500 N Vtcn1 n/a
3 TRCN0000257844 GGAATGCAAACCTTGAGTATA pLKO_005 516 CDS 100% 13.200 9.240 N Vtcn1 n/a
4 TRCN0000249190 TCGTATCTGTGCTCTACAATG pLKO_005 729 CDS 100% 10.800 7.560 N Vtcn1 n/a
5 TRCN0000249189 TCGTCATCCAGTGGCTGAAAG pLKO_005 300 CDS 100% 10.800 7.560 N Vtcn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178594.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12592 pDONR223 100% 56.3% 59% None (many diffs) n/a
2 ccsbBroad304_12592 pLX_304 0% 56.3% 59% V5 (many diffs) n/a
3 TRCN0000465576 TTCAATATGGCCTGAGTCCGTGCG pLX_317 62.1% 56.3% 59% V5 (many diffs) n/a
Download CSV