Transcript: Mouse NM_178604.3

Mus musculus thioredoxin-like 4A (Txnl4a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Txnl4a (27366)
Length:
1795
CDS:
254..445

Additional Resources:

NCBI RefSeq record:
NM_178604.3
NBCI Gene record:
Txnl4a (27366)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178604.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114572 GCTAAGTATGTATCCCTGCAT pLKO.1 865 3UTR 100% 2.640 3.696 N Txnl4a n/a
2 TRCN0000114574 CAGGGCCATGATTGAGAACTT pLKO.1 840 3UTR 100% 4.950 3.465 N Txnl4a n/a
3 TRCN0000114575 GATGGCAAAGACAGCACTGAT pLKO.1 1159 3UTR 100% 4.950 3.465 N Txnl4a n/a
4 TRCN0000114573 GCGTATGCTATGAAGCGAGAT pLKO.1 985 3UTR 100% 4.050 2.835 N Txnl4a n/a
5 TRCN0000114571 GCTTTCTGCTTGGAATGCCAA pLKO.1 1496 3UTR 100% 2.640 1.848 N Txnl4a n/a
6 TRCN0000035414 CCCGAGAACTACCAGATGAAA pLKO.1 622 3UTR 100% 5.625 3.375 N NAA10 n/a
7 TRCN0000288748 CCCGAGAACTACCAGATGAAA pLKO_005 622 3UTR 100% 5.625 3.375 N NAA10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178604.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02555 pDONR223 100% 38.7% 36.3% None (many diffs) n/a
2 ccsbBroad304_02555 pLX_304 0% 38.7% 36.3% V5 (many diffs) n/a
3 TRCN0000467428 ACCCGCCTCTGCCGCGGTAATACA pLX_317 73.9% 38.7% 36.3% V5 (many diffs) n/a
Download CSV